Molecule Information

General Information of the Molecule (ID: Mol05223)

• Name: hsa-miR-133a-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCC
  CCUUCAACCAGCUGUAGCUAUGCAUUGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H1993 cells; Lymph node; Homo sapiens (Human); CVCL_1512
• In Vitro Model: H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay; Colony formation assay; Cell cycle analysis; Cell apoptosis and growth rate assays
• Mechanism Description: We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.The mimic of miR-346, however, does not rescue the cytotoxic effect of the miR-346 inhibitor, suggesting that the cytotoxicity of the miR-346 inhibitor is most likely to be caused by off-target effects of the synthetic oligo rather than knocking down the expression of the endogenous miR-346.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [3]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• In Vivo Model: Metastatic Renal Cell Carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; TaqMan low-density arrays; Western blot
• Experiment for Drug Resistance: MTT assay; Co-culture and cell migration assays
• Mechanism Description: High expression of miR-942, miR-628-5p, miR-133a, and miR-484 was significantly associated with decreased time to progression and overall survival. These microRNAs were also overexpressed in the sunitinib resistant cell line Caki-2 in comparison with the sensitive cell line.

References

• Ref 1: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 2: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 3: Novel ATP-competitive MEK inhibitor E6201 is effective against vemurafenib-resistant melanoma harboring the MEK1-C121S mutation in a preclinical modelMol Cancer Ther. 2014 Apr;13(4):823-32. doi: 10.1158/1535-7163.MCT-13-0667. Epub 2014 Jan 21.