Molecule Information

General Information of the Molecule (ID: Mol05214)

• Name: hsa-miR-433 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGA
  AGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Fluorouracil

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay, WST-8 assay
• Mechanism Description: The results indicate that miR-433 post-transcriptionally regulates the expression of TYMS mRNA and protein, and increases sensitivity to 5-FU in HeLa cells. This is the first report showing that a miRNA regulating TYMS expression has a significant impact on sensitivity to 5-FU treatment.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Whole-genome and miRNA sequencing chips; qRT-PCR; Western blot; ChIP assay; RIP assay; Dual-luciferase reporter assay; RNA pull-down assay
• Experiment for Drug Resistance: CCK8 assay; Apoptosis assay; Transwell assay
• Mechanism Description: Our findings illustrate that NORAD, activated by the oxidative stress, can positively regulate ATG5 and ATG12 and enhance the autophagy flux by sponging miR-433-3p.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: OVCA432 cells; Ovary; Homo sapiens (Human); CVCL_3769
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• Experiment for Molecule Alteration: Immunohistochemistry; qRT-PCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Importantly, reduced MAD2 protein expression in pre-miR-433-transfected A2780 cells rendered these cells less sensitive to paclitaxel. In conclusion, loss of MAD2 protein expression results in increased resistance to paclitaxel in EOC cells. Measuring MAD2 IHC staining intensity may predict paclitaxel responses in women presenting with high-grade serous EOC.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 3: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 4: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.