Molecule Information

General Information of the Molecule (ID: Mol05114)

• Name: hsa-miR-24-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGG
  AACAGGAG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Lung cancer patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR, Mann-Whitney U test
• Experiment for Drug Resistance: WST-8 test
• Mechanism Description: We compared the miRNA expression levels between benign and malignant effusions using a Mann-Whitney U test and found miR-24, miR-26a and miR-30d were expressed differently between the two groups (P = 0.006, 0.021 and 0.011, respectively). Cells isolated from effusions rich in cell-free miR-152 were more sensitive to docetaxel (r = 0.60, P = 0.016). Collectively, our study demonstrated that cell-free miRNAs in the supernatant of effusions may aid in the diagnosis of malignancy and predict chemosensitivity to docetaxel.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Fibrosarcoma [.] [3]

• Resistant Disease: Fibrosarcoma [.]
• Resistant Drug: Methotrexate
• Molecule Alteration: Mutations; 829C->T
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT1080 cells; Acetabulum; Homo sapiens (Human); CVCL_0317
• Experiment for Molecule Alteration: Western blot; RT-qPCR
• Experiment for Drug Resistance: MTX Cytotoxicity
• Mechanism Description: Overexpression of miR-24 in cells with WT DHFR resulted in down-regulation of DHFR protein, whereas no effect on DHFR protein expression was observed in the mutant 3' UTR-expressing cells. Inhibition of endogenous miR-24 with a specific inhibitor led to up-regulation of DHFR in WT and not in mutant cells. Cells with the mutant 3' UTR had a 2-fold increase in DHFR mRNA half-life, expressed higher DHFR mRNA and DHFR protein, and were 4-fold more resistant to methotrexate as compared with WT cells. SNP-829C->T, therefore, leads to a decrease in microRNA binding leading to overexpression of its target and results in resistance to methotrexate.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7/PR cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The present study identified that miR-24 was significantly downregulated in paclitaxel-resistant (PR) breast cancer patients and in MCF-7/PR human breast carcinoma cells, and that overexpression of miR-24 could increase the effect of paclitaxel on drug-resistant breast carcinoma cells. Furthermore, miR-24 could directly bind to the 3'-untranslated region of ATP binding cassette B9 to downregulate its expression, thereby reducing drug transportation and improving the anti-tumor effect of paclitaxel on breast cancer cells. In vivo experiments also demonstrated that overexpression of miR-24 could increase the sensitivity of drug-resistant MCF-7 cells to paclitaxel.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray profiling, TaqMan Reverse Transcription (RT)-PCR for miRNA Quantification
• Experiment for Drug Resistance: Cell Proliferation Assay, Apoptosis Assay
• Mechanism Description: miRNA microarray analysis of MCF-7 cell lines that are either sensitive (parental) or resistant (4-hydroxytamoxifen-resistant (OHTR)) to tamoxifen showed significant (>1.8-fold) up-regulation of eight miRNAs and marked down-regulation (>50%) of seven miRNAs in OHTRcells compared with parental MCF-7 cells.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Effects of CYP2C19 genotype on outcomes of clopidogrel treatment. N Engl J Med. 2010 Oct 28;363(18):1704-14. doi: 10.1056/NEJMoa1008410. Epub 2010 Aug 29.
• Ref 3: Cloning vectors, mutagenesis, and gene disruption (ermR) for the erythromycin-producing bacterium Aeromicrobium erythreum. Appl Environ Microbiol. 1991 Sep;57(9):2758-61. doi: 10.1128/aem.57.9.2758-2761.1991.
• Ref 4: Characterization of LY3023414, a Novel PI3K/mTOR Dual Inhibitor Eliciting Transient Target Modulation to Impede Tumor GrowthMol Cancer Ther. 2016 Oct;15(10):2344-2356. doi: 10.1158/1535-7163.MCT-15-0996. Epub 2016 Jul 20.
• Ref 5: MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.