Molecule Information

General Information of the Molecule (ID: Mol05110)

• Name: hsa-miR-191 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCU
  GCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Increased expression of hsa-mir-191.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.