Molecule Information

General Information of the Molecule (ID: Mol05097)

• Name: hsa-miR-106b ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGU
  GGGUACUUGCUGCUCCAGCAGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
• Experiment for Drug Resistance: Apoptosis Assay; Cell Viability Assay
• Mechanism Description: Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: BTG3/Bcl-xL/p27 signalling pathway; Regulation; N.A.
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [5]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: Water-soluble tetrazolium salt (WST)-based assay
• Mechanism Description: We then performed a comprehensive analysis of miRNA expressions in U251R and parental cells using miRNA microarrays. miR-195, miR-455-3p and miR-10a* were the three most up-regulated miRNAs in the resistant cells. Thirteen miRNAs were overexpressed (>2.0-fold) and two were underexpressed (<0.5-fold) in U251R cells compared to U251Wt cells. In addition, using in silico analysis combined with cDNA microarray experiment, we present possible mRNA targets of these miRNAs.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 3: MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
• Ref 4: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
• Ref 5: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.