Molecule Information

General Information of the Molecule (ID: Mol05096)

Name	hsa-miR-103a-1 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUAC AGGGCUAUGAAGGCAUUG Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1]				[1]
Resistant Disease	Colon cancer [ICD-11: 2B90.1]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	DLD-1 cells	Colon	Homo sapiens (Human)	CVCL_0248
	KM12C cells	Colon	Homo sapiens (Human)	CVCL_9547
	DLD-1 cells	Colon	Homo sapiens (Human)	CVCL_0248
	KM12C cells	Colon	Homo sapiens (Human)	CVCL_9547
Experiment for Molecule Alteration	MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for Drug Resistance	Cell proliferation assay; Flow cytometry
Mechanism Description	We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for Drug Resistance	CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description	Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Etoposide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[3]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Etoposide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	Hela cells	Cervix uteri	Homo sapiens (Human)	CVCL_0030
	H1299 cells	Lung	Homo sapiens (Human)	CVCL_0060
Experiment for Molecule Alteration	Immunofluorescence; Western blot; RT-PCR; Luciferase assay
Experiment for Drug Resistance	HR assay; Cell cycle analysis; Survival assay
Mechanism Description	Subsequent study focused on two of the strongest candidates, miR-103 and miR-107, as they are frequently deregulated in cancer

Olaparib

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[3]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Olaparib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	Hela cells	Cervix uteri	Homo sapiens (Human)	CVCL_0030
	H1299 cells	Lung	Homo sapiens (Human)	CVCL_0060
Experiment for Molecule Alteration	Immunofluorescence; Western blot; RT-PCR; Luciferase assay
Experiment for Drug Resistance	HR assay; Cell cycle analysis; Survival assay
Mechanism Description	Subsequent study focused on two of the strongest candidates, miR-103 and miR-107, as they are frequently deregulated in cancer

Tamoxifen

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[5]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	LCC2 cells	Breast	Homo sapiens (Human)	CVCL_DP51
	LCC9 cells	Breast	Homo sapiens (Human)	CVCL_DP52
Experiment for Molecule Alteration	Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description	Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Clinical Trial Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Camptothecin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[3]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Camptothecin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
	Hela cells	Cervix uteri	Homo sapiens (Human)	CVCL_0030
	H1299 cells	Lung	Homo sapiens (Human)	CVCL_0060
Experiment for Molecule Alteration	Immunofluorescence; Western blot; RT-PCR; Luciferase assay
Experiment for Drug Resistance	HR assay; Cell cycle analysis; Survival assay
Mechanism Description	Subsequent study focused on two of the strongest candidates, miR-103 and miR-107, as they are frequently deregulated in cancer

References

Ref 1	Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2	Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 3	The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 4	The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 5	PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.