Molecule Information

General Information of the Molecule (ID: Mol05092)

• Name: hsa-miR-1236 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GUGAGUGACAGGGGAAAUGGGGAUGGACUGGAAGUGGGCAGCAUGGAGCUGACCUUCAUC
  AUGGCUUGGCCAACAUAAUGCCUCUUCCCCUUGUCUCUCCAG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.