Molecule Information
General Information of the Molecule (ID: Mol05092)
| Name |
hsa-miR-1236
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Precursor miRNA
|
||||
| Sequence |
GUGAGUGACAGGGGAAAUGGGGAUGGACUGGAAGUGGGCAGCAUGGAGCUGACCUUCAUC
AUGGCUUGGCCAACAUAAUGCCUCUUCCCCUUGUCUCUCCAG Click to Show/Hide
|
||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | |||
| Resistant Drug | Cyclophosphamide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Diffuse large B cell lymphoma patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Diffuse large B cell lymphoma patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | |||
| Resistant Drug | Prednisone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Diffuse large B cell lymphoma patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.1] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Diffuse large B cell lymphoma patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
