Molecule Information

General Information of the Molecule (ID: Mol05086)

• Name: hsa-miR-589 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UCCAGCCUGUGCCCAGCAGCCCCUGAGAACCACGUCUGCUCUGAGCUGGGUACUGCCUGU
  UCAGAACAAAUGCCGGUUCCCAGACGCUGCCAGCUGGCC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [2]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IOSE386 cells; Ovary; Homo sapiens (Human); CVCL_E230
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: TUOC1 cells; Ovary; Homo sapiens (Human); CVCL_L700
• In Vitro Model: OVCAR-3 cells; Ascites; Homo sapiens (Human); CVCL_0465
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: KK cells; Ascites; Homo sapiens (Human); CVCL_F844
• In Vitro Model: KOC7C cells; Pleural effusion; Homo sapiens (Human); CVCL_5307
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Seventeen miRNAs were overexpressed in Taxol-resistant cells, including miR-663, miR-622, and HS_188

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 2: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 3: Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.