Molecule Information

General Information of the Molecule (ID: Mol05082)

Name	hsa-miR-520d ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	UCUCAAGCUGUGAGUCUACAAAGGGAAGCCCUUUCUGUUGUCUAAAAGAAAAGAAAGUGC UUCUCUUUGGUGGGUUACGGUUUGAGA Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]			[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]		Disease Info
Resistant Drug	Fluorouracil		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vivo Model	Gastric cancer patients		Homo sapiens
Experiment for Molecule Alteration	qRT-PCR
Mechanism Description	Six miRNAs that were associated with chemoresistance, including miR-518f, miR-520a, miR-520d, miR-519e, miR-363, and miR-517, miRNAs that may comprise a clinically relevant signature for intrinsic resistance of gastric cancer to CF and suggests that these miRNAs were selected for during the development of acquired chemoresistance. Since this miRNA predictor may possibly provide a useful guide to personalized chemotherapy in the future, it warrants further investigation and validation in large prospective studies.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Verapamil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Verapamil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

Ref 1	PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 2	The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.