Molecule Information

General Information of the Molecule (ID: Mol05073)

• Name: hsa-miR-367 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CCAUUACUGUUGCUAAUAUGCAACUCUGUUGAAUAUAAAUUGGAAUUGCACUUUAGCAAU
  GGUGAUGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [2]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Signal transduction_PKA signaling, Signal transduction_cAMP signaling; Regulation; N.A.
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVCA429 cells; Ovary; Homo sapiens (Human); CVCL_3936
• In Vitro Model: OVCA432 cells; Ovary; Homo sapiens (Human); CVCL_3769
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: PEO1 cells; Ovary; Homo sapiens (Human); CVCL_2686
• In Vitro Model: PEO4 cells; Ovary; Homo sapiens (Human); CVCL_2690
• In Vitro Model: TOV-112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: OVCAR10 cells; Ovary; Homo sapiens (Human); CVCL_4377
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR4 cells; Ovary; Homo sapiens (Human); CVCL_1627
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Based on miRNA expression and GI50 data, Pearson's correlation test identified 35 miRNAs associated with in vitro paclitaxel sensitivity (P<0.05). Overexpression of miR-367 in the paclitaxel-sensitive cells [PA1; IC50, 1.69 nM, high miR-367 (2.997), low miR-30a-5p (?0.323)] further increased paclitaxel sensitivity, whereas miR-367 depletion decreased paclitaxel sensitivity.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 2: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.