Molecule Information
General Information of the Molecule (ID: Mol05063)
| Name |
hsa-miR-520a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Precursor miRNA
|
||||
| Sequence |
CUCAGGCUGUGACCCUCCAGAGGGAAGUACUUUCUGUUGUCUGAGAGAAAAGAAAGUGCU
UCCCUUUGGACUGUUUCGGUUUGAG Click to Show/Hide
|
||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Gastric cancer patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Mechanism Description | Six *miRNAs that were associated with chemoresistance, including miR-518f*, miR-520a, miR-520d*, miR-519e*, miR-363*, and miR-517*, miRNAs that may comprise a clinically relevant signature for intrinsic resistance of gastric cancer to CF and suggests that these miRNAs were selected for during the development of acquired chemoresistance. Since this miRNA predictor may possibly provide a useful guide to personalized chemotherapy in the future, it warrants further investigation and validation in large prospective studies. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Gastric cancer patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Mechanism Description | Six *miRNAs that were associated with chemoresistance, including miR-518f*, miR-520a, miR-520d*, miR-519e*, miR-363*, and miR-517*, miRNAs that may comprise a clinically relevant signature for intrinsic resistance of gastric cancer to CF and suggests that these miRNAs were selected for during the development of acquired chemoresistance. Since this miRNA predictor may possibly provide a useful guide to personalized chemotherapy in the future, it warrants further investigation and validation in large prospective studies. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
