General Information of the Molecule (ID: Mol05063)
Name
hsa-miR-520a ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
CUCAGGCUGUGACCCUCCAGAGGGAAGUACUUUCUGUUGUCUGAGAGAAAAGAAAGUGCU
UCCCUUUGGACUGUUUCGGUUUGAG
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Gastric cancer patients Homo sapiens
Experiment for
Molecule Alteration
qRT-PCR
Mechanism Description Six *miRNAs that were associated with chemoresistance, including miR-518f*, miR-520a, miR-520d*, miR-519e*, miR-363*, and miR-517*, miRNAs that may comprise a clinically relevant signature for intrinsic resistance of gastric cancer to CF and suggests that these miRNAs were selected for during the development of acquired chemoresistance. Since this miRNA predictor may possibly provide a useful guide to personalized chemotherapy in the future, it warrants further investigation and validation in large prospective studies.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Gastric cancer patients Homo sapiens
Experiment for
Molecule Alteration
qRT-PCR
Mechanism Description Six *miRNAs that were associated with chemoresistance, including miR-518f*, miR-520a, miR-520d*, miR-519e*, miR-363*, and miR-517*, miRNAs that may comprise a clinically relevant signature for intrinsic resistance of gastric cancer to CF and suggests that these miRNAs were selected for during the development of acquired chemoresistance. Since this miRNA predictor may possibly provide a useful guide to personalized chemotherapy in the future, it warrants further investigation and validation in large prospective studies.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 2 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.