Molecule Information

General Information of the Molecule (ID: Mol05043)

• Name: hsa-miR-582 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  AUCUGUGCUCUUUGAUUACAGUUGUUCAACCAGUUACUAAUCUAACUAAUUGUAACUGGU
  UGAACAACUGAACCCAAAGGGUGCAAAGUAGAAACAUU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta-catenin pathway; Regulation; N.A.
• In Vitro Model: MS751 cells; Cervical; Homo sapiens (Human); CVCL_4996
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: C33A cells; Uterus; Homo sapiens (Human); CVCL_1094
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: ME-180 cells; Uterus; Homo sapiens (Human); CVCL_1401
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR; Western blot; Nanoparticle tracking analysis; Luciferase reporter assay; Fluorescence in situ hybridization (FISH); Immunofluorescence (IF) staining; Immunofluorescence; RNA immunoprecipitation (RIP) assay; RNA pull-down assay; Comet assay
• Experiment for Drug Resistance: CCK-8 assay; Transwell assay
• Mechanism Description: Moreover, PDHB-AS inactivated the Wnt/beta-catenin pathway via impeding the nuclear translocation of beta-catenin in CC cells.PDHB-AS recruited poly(A) binding protein cytoplasmic 1 (PABPC1) to inhibit Wnt7b expression.In addition, miR-582-5p could bind with both PDHB-AS and Dickkopf-1 (DKK1).

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [4]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 4: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.