Molecule Information

General Information of the Molecule (ID: Mol05037)

• Name: hsa-miR-605 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GCCCUAGCUUGGUUCUAAAUCCCAUGGUGCCUUCUCCUUGGGAAAAACAGAGAAGGCACU
  AUGAGAUUUAGAAUCAAGUUAGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR; Western blot
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: B4 database showed that these two agents modulated a number of microRNAs (miR-21, miR-196a, miR-495, miR-605, miR-638, and miR-453) linked to various canonical oncogenic signaling pathways

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
• Ref 2: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 3: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 4: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.