Molecule Information

General Information of the Molecule (ID: Mol05025)

Name	hsa-miR-454 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	UCUGUUUAUCACCAGAUCCUAGAACCCUAUCAAUAUUGUCUCUGCUGUGUAAAUAGUUCU GAGUAGUGCAAUAUUGCUUAUAGGGUUUUGGUGUUUGGAAAGAACAAUGGGCAGG Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Docetaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0]				[1]
Resistant Disease	Prostate cancer [ICD-11: 2C82.0]			Disease Info
Resistant Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	PC3 cells	Prostate	Homo sapiens (Human)	CVCL_0035
	DU145 cells	Prostate	Homo sapiens (Human)	CVCL_0105
Experiment for Molecule Alteration	qPCR
Mechanism Description	Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-454 is increased.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[3]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Verapamil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[3]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Verapamil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	MiRNA microarray; RT-PCR; Western blot
Experiment for Drug Resistance	MTT assay
Mechanism Description	MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

Ref 1	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 2	BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
Ref 3	The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.