Molecule Information

General Information of the Molecule (ID: Mol05011)

• Name: hsa-miR-196a-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCA
  CCCGAUUCAC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay
• Mechanism Description: Here, 183 differentially expressed miRNAs were identified in the two resistant sublines compared to MCF-7/S. Then, five up-regulated miRNAs (miR-100, miR-29a, miR-196a, miR-222 and miR-30a) in both MCF-7/Adr and MCF-7/Doc were selected to explore their roles in acquisition of drug-resistance using transfection experiment. The results showed that miR-222 and miR-29a mimics and inhibitors had partially changed the drug-resistance of breast cancer cells, which was also confirmed by apoptosis assay. Western blot results suggested that miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells. Finally, pathway mapping tools were employed to further analyze signaling pathways affected by the two miRNAs. In summary, this study demonstrates that altered miRNA expression pattern is involved in acquiring resistance to Adr and Doc in breast cancer MCF-7 cells, and that there are some miRNAs who displayed consistent up- or down-regulated expression changes in the two resistant sublines. The most importance is that we identify two miRNAs (miR-222 and miR-29a) involved in drug-resistance, at least in part via targeting PTEN.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [5]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [7]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 3: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 4: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 5: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
• Ref 6: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 7: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.