Molecule Information

General Information of the Molecule (ID: Mol05002)

• Name: hsa-miR-128-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAAC
  CGGUCUCUUUUUCAGCUGCUUC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 13 drug(s) in total

Anastrozole

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Anastrozole
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SUM1315 cells; Breast; Homo sapiens (Human); CVCL_5589
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We focused our work on hsa-miR-128a which was hormone-responsive and selectively up-regulated in the letrozole-resistant cell lines. Human miR-128a was predicted to target the TGFbeta signaling pathway and indeed sensitivity to TGFbeta was compromised in the letrozole-resistant cells, as compared to parental MCF-7aro. Human miR-128a was shown to negatively target TGFbetaRI protein expression by binding to the 3'UTR region of the gene. Inhibition of endogenous miR-128a resulted in re-sensitization of the letrozole-resistant lines to TGFbeta growth inhibitory effects.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-128/HMGA2; Regulation; N.A.
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: SNU-1 cells; Gastric; Homo sapiens (Human); CVCL_0099
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; luciferase reporter assay; Immunohistochemical analysis
• Experiment for Drug Resistance: Flow cytometry assay; Drug sensitivity assay
• Mechanism Description: HCP5 contributes to cisplatin resistance in gastric cancer through miR-128/HMGA2 axis

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Etoposide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Breast cancer patient tumour model; Homo sapiens
• Experiment for Molecule Alteration: Luciferase report assay
• Experiment for Drug Resistance: Flowcytometry
• Mechanism Description: miR-128 is more highly expressed in drug-resistant breast cancer samples than in drug-sensitive samples. We have confirmed that Bax is the target of miR-128 by negative post-transcriptional regulation. miR-128 and Bax were detected in the breast cancer cell line, MDA-MB-231, which was then transfected with miR-128 MIMIC (precursor of miR-128) or AMO (antisense-miR-128 oligonucleotides). After transfection, the chemosensitivity of MDA-MB-231 cell was up-regulated with increasing of Bax and inhibition of miR-128.

Exemestane

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Exemestane
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SUM1315 cells; Breast; Homo sapiens (Human); CVCL_5589
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We focused our work on hsa-miR-128a which was hormone-responsive and selectively up-regulated in the letrozole-resistant cell lines. Human miR-128a was predicted to target the TGFbeta signaling pathway and indeed sensitivity to TGFbeta was compromised in the letrozole-resistant cells, as compared to parental MCF-7aro. Human miR-128a was shown to negatively target TGFbetaRI protein expression by binding to the 3'UTR region of the gene. Inhibition of endogenous miR-128a resulted in re-sensitization of the letrozole-resistant lines to TGFbeta growth inhibitory effects.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: c-met/PI3K/AKT; Regulation; N.A.
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vivo Model: BALB/c, nu/nu nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Apoptosis analysis
• Mechanism Description: MiR-128 reverses the gefitinib resistance of the lung cancer stem cells by inhibiting the c-met/PI3K/AKT pathway

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [6]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Letrozole

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Letrozole
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SUM1315 cells; Breast; Homo sapiens (Human); CVCL_5589
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We focused our work on hsa-miR-128a which was hormone-responsive and selectively up-regulated in the letrozole-resistant cell lines. Human miR-128a was predicted to target the TGFbeta signaling pathway and indeed sensitivity to TGFbeta was compromised in the letrozole-resistant cells, as compared to parental MCF-7aro. Human miR-128a was shown to negatively target TGFbetaRI protein expression by binding to the 3'UTR region of the gene. Inhibition of endogenous miR-128a resulted in re-sensitization of the letrozole-resistant lines to TGFbeta growth inhibitory effects.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qPCR; Dual-luciferase reporter assay; Western blot
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: IRF-1 mediated long non-coding RNA PVT1-214 promotes oxaliplatin resistance of colorectal cancer via miR-128 inhibition

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [7]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-qPCR; TaqMan assay; Northern blot analysis; Western blot; Luciferase assay
• Mechanism Description: A microarray platform optimised for the analysis of a panel of 381 human microRNA was used to analyse and compare the pattern of microRNAs expression between parental human ovarian cancer A2780wt cell line and its counterparts made resistant to cisplatin (A2780CIS) and paclitaxel (A2780TAX, resistance P-glycoprotein-dependent), and TC1/TC3, made resistant to paclitaxel in the presence of cyclosporine as inhibitor of P-glycoprotein. The expression of hsa-mir-128-1 is elevated in drug-resistant cells.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SUM1315 cells; Breast; Homo sapiens (Human); CVCL_5589
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We focused our work on hsa-miR-128a which was hormone-responsive and selectively up-regulated in the letrozole-resistant cell lines. Human miR-128a was predicted to target the TGFbeta signaling pathway and indeed sensitivity to TGFbeta was compromised in the letrozole-resistant cells, as compared to parental MCF-7aro. Human miR-128a was shown to negatively target TGFbetaRI protein expression by binding to the 3'UTR region of the gene. Inhibition of endogenous miR-128a resulted in re-sensitization of the letrozole-resistant lines to TGFbeta growth inhibitory effects.

Temozolomide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [8]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Human primary brain tumor; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR; Luciferase assay; Western blot; Immunofluorescence
• Experiment for Drug Resistance: Colony formation assay; Cell viability assay; Wound closure assay; Transwell migration assay
• Mechanism Description: In the present study, we demonstrated that the expression of miR-128 and miR-149 was downregulated in glioblastoma, and their overexpression inhibited the invasion of glioblastoma cells by targeting Rap1B-mediated cytoskeletal and related molecular alterations. Moreover, miR-128 and miR-149 enhanced the chemosensitivity of glioblastoma cells to TMZ.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Molecular mechanisms of secondary imatinib resistance in patients with gastrointestinal stromal tumors. J Cancer Res Clin Oncol. 2010 Jul;136(7):1065-71. doi: 10.1007/s00432-009-0753-7. Epub 2009 Dec 31.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 4: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 5: Characterization of LY3023414, a Novel PI3K/mTOR Dual Inhibitor Eliciting Transient Target Modulation to Impede Tumor GrowthMol Cancer Ther. 2016 Oct;15(10):2344-2356. doi: 10.1158/1535-7163.MCT-15-0996. Epub 2016 Jul 20.
• Ref 6: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 7: Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86. doi: 10.1016/j.ygyno.2008.08.017. Epub 2008 Sep 26.
• Ref 8: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.