Molecule Information
General Information of the Molecule (ID: Mol01739)
Name |
hsa-miR-543
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 543
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAACAUUCGCGGUGCACUUCUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
PTEN/PI3K/AKT signaling pathway | Activation | hsa05235 | ||
In Vitro Model | HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Transwell assay; Flow cytometry assay | |||
Mechanism Description | miR-543 enhanced drug resistance by down-regulating the expression of phosphatase and tensin homolog (PTEN), which negatively regulates protein kinase B (AkT) activation while an elevated expression of PTEN reversed the chemoresistance of miR-543-overexpressing HCT8 cells to 5-FU. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.