Molecule Information
General Information of the Molecule (ID: Mol01739)
| Name |
hsa-miR-543
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 543
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AAACAUUCGCGGUGCACUUCUU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [1] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| PTEN/PI3K/AKT signaling pathway | Activation | hsa05235 | ||
| In Vitro Model | HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell assay; Flow cytometry assay | |||
| Mechanism Description | miR-543 enhanced drug resistance by down-regulating the expression of phosphatase and tensin homolog (PTEN), which negatively regulates protein kinase B (AkT) activation while an elevated expression of PTEN reversed the chemoresistance of miR-543-overexpressing HCT8 cells to 5-FU. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
