Molecule Information

General Information of the Molecule (ID: Mol01724)

• Name: hsa-miR-513a-3p ,Homo sapiens
• Synonyms: microRNA 513a-1
• Molecule Type: Mature miRNA
• Sequence: UAAAUUUCACCUUUCUGAGAAGG
• Ensembl ID: ENSG00000207873
• HGNC ID: HGNC:32141
• Mature Accession: MIMAT0004777

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [1]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: GSTP1 augment drug resistance by catalyzing GSH-drug binding, exogenous miR-513a-3p plays a role in sensitizing human lung adenocarcinoma cell lines to cisplatin by repressing GSTP1 expression at the translational level.

References

• Ref 1: miR-513a-3p sensitizes human lung adenocarcinoma cells to chemotherapy by targeting GSTP1. Lung Cancer. 2012 Sep;77(3):488-94. doi: 10.1016/j.lungcan.2012.05.107. Epub 2012 Jun 30.