General Information of the Molecule (ID: Mol01709)
Name
hsa-miR-125a-3p ,Homo sapiens
Synonyms
microRNA 125a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
ACAGGUGAGGUUCUUGGGAGCC
    Click to Show/Hide
Ensembl ID
ENSG00000208008
HGNC ID
HGNC:31505
Mature Accession
MIMAT0004602
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MTA1 signaling pathway Activation hsa05206
In Vitro Model LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
ELISA; MTT assay
Mechanism Description Regulation of docetaxel sensitivity in prostate cancer cells by hsa-miR125a-3p via modulation of metastasis-associated protein 1 signaling, MTA1 is a direct target of hsa-mir125a-3p in pca cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
MCF-7/LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
MECs cells Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Enforced expression of hsa-miR125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell viability Inhibition hsa05200
Epithelial mesenchymal transition signaling pathway Inhibition hsa01521
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
PATU8988T cells Pancreatic Homo sapiens (Human) CVCL_1847
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; Transwell assay
Mechanism Description miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn.
References
Ref 1 Regulation of Docetaxel Sensitivity in Prostate Cancer Cells by hsa-miR-125a-3p via Modulation of Metastasis-Associated Protein 1 Signaling. Urology. 2017 Jul;105:208.e11-208.e17. doi: 10.1016/j.urology.2017.01.001. Epub 2017 Jan 11.
Ref 2 Enforced expression of hsa-miR-125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling. Biochem Biophys Res Commun. 2016 Oct 28;479(4):893-900. doi: 10.1016/j.bbrc.2016.09.087. Epub 2016 Sep 28.
Ref 3 miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn. Biomed Pharmacother. 2018 Oct;106:523-531. doi: 10.1016/j.biopha.2018.06.114. Epub 2018 Jul 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.