Molecule Information
General Information of the Molecule (ID: Mol01709)
| Name |
hsa-miR-125a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 125a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
ACAGGUGAGGUUCUUGGGAGCC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [1] | |||
| Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MTA1 signaling pathway | Activation | hsa05206 | |
| In Vitro Model | LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 |
| PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
ELISA; MTT assay | |||
| Mechanism Description | Regulation of docetaxel sensitivity in prostate cancer cells by hsa-miR125a-3p via modulation of metastasis-associated protein 1 signaling, MTA1 is a direct target of hsa-mir125a-3p in pca cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| MCF-7/LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| MECs cells | Breast | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Enforced expression of hsa-miR125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [3] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell viability | Inhibition | hsa05200 | ||
| Epithelial mesenchymal transition signaling pathway | Inhibition | hsa01521 | ||
| In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| PATU8988T cells | Pancreatic | Homo sapiens (Human) | CVCL_1847 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Transwell assay | |||
| Mechanism Description | miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
