Molecule Information
General Information of the Molecule (ID: Mol01709)
Name |
hsa-miR-125a-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 125a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACAGGUGAGGUUCUUGGGAGCC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [1] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | MTA1 signaling pathway | Activation | hsa05206 | |
In Vitro Model | LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
ELISA; MTT assay | |||
Mechanism Description | Regulation of docetaxel sensitivity in prostate cancer cells by hsa-miR125a-3p via modulation of metastasis-associated protein 1 signaling, MTA1 is a direct target of hsa-mir125a-3p in pca cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [2] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
MCF-7/LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
MECs cells | Breast | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Enforced expression of hsa-miR125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic ductal adenocarcinoma | [3] | |||
Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell viability | Inhibition | hsa05200 | ||
Epithelial mesenchymal transition signaling pathway | Inhibition | hsa01521 | ||
In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
PATU8988T cells | Pancreatic | Homo sapiens (Human) | CVCL_1847 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.