Molecule Information

General Information of the Molecule (ID: Mol01709)

Name	hsa-miR-125a-3p ,Homo sapiens
Synonyms	microRNA 125a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	ACAGGUGAGGUUCUUGGGAGCC Click to Show/Hide
Ensembl ID	ENSG00000208008
HGNC ID	HGNC:31505
Mature Accession	MIMAT0004602
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Docetaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Prostate cancer				[1]
Resistant Disease	Prostate cancer [ICD-11: 2C82.0]			Disease Info
Resistant Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	MTA1 signaling pathway		Activation	hsa05206
In Vitro Model	LNCaP cells	Prostate	Homo sapiens (Human)	CVCL_0395
	PC3 cells	Prostate	Homo sapiens (Human)	CVCL_0035
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	ELISA; MTT assay
Mechanism Description	Regulation of docetaxel sensitivity in prostate cancer cells by hsa-miR125a-3p via modulation of metastasis-associated protein 1 signaling, MTA1 is a direct target of hsa-mir125a-3p in pca cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[2]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
	MDA-MB-468 cells	Breast	Homo sapiens (Human)	CVCL_0419
	MCF-7/LCC2 cells	Breast	Homo sapiens (Human)	CVCL_DP51
	MECs cells	Breast	Homo sapiens (Human)	N.A.
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Enforced expression of hsa-miR125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling.

Gemcitabine

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma				[3]
Sensitive Disease	Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]			Disease Info
Sensitive Drug	Gemcitabine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell invasion		Inhibition	hsa05200
	Cell migration		Inhibition	hsa04670
	Cell viability		Inhibition	hsa05200
	Epithelial mesenchymal transition signaling pathway		Inhibition	hsa01521
In Vitro Model	PANC-1 cells	Pancreas	Homo sapiens (Human)	CVCL_0480
	PATU8988T cells	Pancreatic	Homo sapiens (Human)	CVCL_1847
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay; Transwell assay
Mechanism Description	miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn.

References

Ref 1	Regulation of Docetaxel Sensitivity in Prostate Cancer Cells by hsa-miR-125a-3p via Modulation of Metastasis-Associated Protein 1 Signaling. Urology. 2017 Jul;105:208.e11-208.e17. doi: 10.1016/j.urology.2017.01.001. Epub 2017 Jan 11.
Ref 2	Enforced expression of hsa-miR-125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling. Biochem Biophys Res Commun. 2016 Oct 28;479(4):893-900. doi: 10.1016/j.bbrc.2016.09.087. Epub 2016 Sep 28.
Ref 3	miR-125a-3p is responsible for chemosensitivity in PDAC by inhibiting epithelial-mesenchymal transition via Fyn. Biomed Pharmacother. 2018 Oct;106:523-531. doi: 10.1016/j.biopha.2018.06.114. Epub 2018 Jul 11.