Molecule Information
General Information of the Molecule (ID: Mol01699)
| Name |
hsa-miR-765
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 765
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGGAGGAGAAGGAAGGUGAUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [2] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| RT112 cells | Bladder | Homo sapiens (Human) | CVCL_1670 | |
| Experiment for Molecule Alteration |
Western blot; Microarray Analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Proliferation Assay | |||
| Mechanism Description | Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
