Molecule Information
General Information of the Molecule (ID: Mol01685)
| Name |
hsa-miR-638
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 638
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGGGAUCGCGGGCGGGUGGCGGCCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [1] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| DNA damage repair signaling pathway | Inhibition | hsa03410 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Matrigel invasion assay | |||
| Mechanism Description | miR-638 overexpression increased sensitivity to DNA-damaging agents, ultraviolet (UV) and cisplatin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | STARD10 signaling pathway | Inhibition | hsa05206 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
ELISA; MTT assay; Transwell invasion assay | |||
| Mechanism Description | Acquired resistance to DTX is caused by the miR638 deficiency and subsequent STARD10 upregulation. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [3] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| Experiment for Molecule Alteration |
Microarray analysis; qRT-PCR; Western blot | |||
| Experiment for Drug Resistance |
Apoptosis assay; Cell viability assay | |||
| Mechanism Description | B4 database showed that these two agents modulated a number of microRNAs (miR-21, miR-196a, miR-495, miR-605, miR-638, and miR-453) linked to various canonical oncogenic signaling pathways | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
