Molecule Information
General Information of the Molecule (ID: Mol01673)
Name |
hsa-miR-587
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 587
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUUCCAUAGGUGAUGAGUCAC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [1] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
miR587/PPP2R1B/pAKT/XIAP signaling pathway | Inhibition | hsa05206 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
FET cells | Colon | Homo sapiens (Human) | CVCL_A604 | |
GEO cells | Colon | Homo sapiens (Human) | CVCL_0271 | |
Experiment for Molecule Alteration |
RT-PCR; RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | microRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by inhibiting PPP2R1B expression in colorectal cancer. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.