Molecule Information
General Information of the Molecule (ID: Mol01673)
| Name |
hsa-miR-587
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 587
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUUCCAUAGGUGAUGAGUCAC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [1] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| miR587/PPP2R1B/pAKT/XIAP signaling pathway | Inhibition | hsa05206 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| FET cells | Colon | Homo sapiens (Human) | CVCL_A604 | |
| GEO cells | Colon | Homo sapiens (Human) | CVCL_0271 | |
| Experiment for Molecule Alteration |
RT-PCR; RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by inhibiting PPP2R1B expression in colorectal cancer. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
