Molecule Information
General Information of the Molecule (ID: Mol01663)
Name |
hsa-miR-520c-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 520c
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAAGUGCUUCCUUUUAGAGGGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Acute myeloid leukemia | [1] | |||
Resistant Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
miR520c-3p/S100A4 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 |
U937 cells | Blood | Homo sapiens (Human) | CVCL_0007 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | HOXA-AS2 Can enhance S100A4 expression by suppressing miR-520c-3p expression to promote adriamycin resistance in acute myeloid leukemia through the miR-520c-3p /S100A4 pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.