Molecule Information

General Information of the Molecule (ID: Mol01663)

Name	hsa-miR-520c-3p ,Homo sapiens
Synonyms	microRNA 520c Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AAAGUGCUUCCUUUUAGAGGGU Click to Show/Hide
Ensembl ID	ENSG00000207738
HGNC ID	HGNC:32108
Mature Accession	MIMAT0002846
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Testicular cancer [.]			[1]
Resistant Disease	Testicular cancer [.]		Disease Info
Resistant Drug	Cisplatin		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	RT-qPCR with "Low Density Array"
Experiment for Drug Resistance	MTT assay
Mechanism Description	Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0]				[2]
Resistant Disease	Acute myeloid leukemia [ICD-11: 2A60.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	miR520c-3p/S100A4 signaling pathway		Regulation	N.A.
In Vitro Model	THP-1 cells	Blood	Homo sapiens (Human)	CVCL_0006
	U937 cells	Blood	Homo sapiens (Human)	CVCL_0007
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	HOXA-AS2 Can enhance S100A4 expression by suppressing miR-520c-3p expression to promote adriamycin resistance in acute myeloid leukemia through the miR-520c-3p /S100A4 pathway.

References

Ref 1	Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
Ref 2	Knockdown of Long Noncoding RNA HOXA-AS2 Suppresses Chemoresistance of Acute Myeloid Leukemia via the miR-520c-3p/S100A4 Axis. Cell Physiol Biochem. 2018;51(2):886-896. doi: 10.1159/000495387. Epub 2018 Nov 22.