General Information of the Molecule (ID: Mol01663)
Name
hsa-miR-520c-3p ,Homo sapiens
Synonyms
microRNA 520c
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AAAGUGCUUCCUUUUAGAGGGU
    Click to Show/Hide
Ensembl ID
ENSG00000207738
HGNC ID
HGNC:32108
Mature Accession
MIMAT0002846
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [1]
Resistant Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
miR520c-3p/S100A4 signaling pathway Regulation N.A.
In Vitro Model THP-1 cells Blood Homo sapiens (Human) CVCL_0006
U937 cells Blood Homo sapiens (Human) CVCL_0007
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description HOXA-AS2 Can enhance S100A4 expression by suppressing miR-520c-3p expression to promote adriamycin resistance in acute myeloid leukemia through the miR-520c-3p /S100A4 pathway.
References
Ref 1 Knockdown of Long Noncoding RNA HOXA-AS2 Suppresses Chemoresistance of Acute Myeloid Leukemia via the miR-520c-3p/S100A4 Axis. Cell Physiol Biochem. 2018;51(2):886-896. doi: 10.1159/000495387. Epub 2018 Nov 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.