Molecule Information

General Information of the Molecule (ID: Mol01661)

• Name: hsa-miR-193b-3p ,Homo sapiens
• Synonyms: microRNA 193b
• Molecule Type: Mature miRNA
• Sequence: AACUGGCCCUCAAAGUCCCGCU
• Ensembl ID: ENSG00000207639
• HGNC ID: HGNC:32087
• Mature Accession: MIMAT0002819

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: 2 platinum-associated miRNAs (miR-193b* and miR-320) that inhibit the expression of five platinum-associated genes (CRIM1, IFIT2, OAS1, kCNMA1 and GRAMD1B). over-expression of miR-193b* in a randomly selected HapMap cell line results in resistance to both carboplatin and cisplatin.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.0] [3]

• Resistant Disease: Liver cancer [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh7 cells; Kidney; Homo sapiens (Human); CVCL_U442
• In Vitro Model: HLE cells; Liver; Homo sapiens (Human); CVCL_1281
• In Vitro Model: HEK293T cells; Kindey; Homo sapiens (Human); CVCL_0063
• In Vivo Model: Liver cancer patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR; Western Immunoblotting; RNA Immunoprecipitation
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: We identi?ed an epigenetic mechanism leading to upregulation of the long intergenic non-coding RNA 152 (LINC00152) expression in human hepatocellular carcinoma (HCC).RNA expression in human HCC in vivo was validated by RNA in situ hybridization. Let-7c-5p, miR-23a-3p, miR-125a-5p, miR-125b-5p, miR-143a-3p, miR-193-3p, and miR-195-5p were detected as new components of the potential LINC00152 ceRNA network in human HCC.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [4]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Ras-MAPK signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: PI3K-AKT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Wnt signalling pathway; Regulation; N.A.
• Experiment for Molecule Alteration: Differential expression analysis; Functional and pathway enrichment analysis; Construction of protein-protein interaction (PPI) networks and screening for key genes
• Mechanism Description: Finally, another upregulated miRNA is hsa-miR-193b-3p, and although higher expression of hsa-miR-193b-3p has been found in glioma and colorectal cancer, it is seen to be a tumor suppressor, and in our study, hsa-miR-193b was found to be upregulated and significantly enriched in pathways effective on both cell viability and proliferation.

References

• Ref 1: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 2: Genetic variation that predicts platinum sensitivity reveals the role of miR-193b* in chemotherapeutic susceptibility. Mol Cancer Ther. 2012 Sep;11(9):2054-61. doi: 10.1158/1535-7163.MCT-12-0221. Epub 2012 Jun 29.
• Ref 3: LINC00152 Drives a Competing Endogenous RNA Network in Human Hepatocellular Carcinoma
• Ref 4: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.