Molecule Information
General Information of the Molecule (ID: Mol01661)
Name |
hsa-miR-193b-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 193b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACUGGCCCUCAAAGUCCCGCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
Alamar Blue assay | |||
Mechanism Description | 2 platinum-associated miRNAs (miR-193b* and miR-320) that inhibit the expression of five platinum-associated genes (CRIM1, IFIT2, OAS1, kCNMA1 and GRAMD1B). over-expression of miR-193b* in a randomly selected HapMap cell line results in resistance to both carboplatin and cisplatin. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.