Molecule Information

General Information of the Molecule (ID: Mol01652)

• Name: hsa-miR-409-3p ,Homo sapiens
• Synonyms: microRNA 409
• Molecule Type: Mature miRNA
• Sequence: GAAUGUUGCUCGGUGAACCCCU
• Ensembl ID: ENSG00000199107
• HGNC ID: HGNC:32055
• Mature Accession: MIMAT0001639

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: FHC cells; Colon; Homo sapiens (Human); CVCL_3688
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: CCD-18Co cells; Colon; Homo sapiens (Human); CVCL_2379
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR 409-3p inhibited Beclin-1 expression and autophagic activity by binding to the 3'-untranslated region of Beclin-1 mRNA. In addition, the overexpression of miR 409-3p (+) the chemosensitivity of the oxaliplatin-sensitive and oxaliplatin-resistant colon cancer cells. The restoration of Beclin-1 abrogated these effects of miR 409-3p. In a xenograft model using nude mice, we examined the effects of miR 409-3p on tumor growth during chemotherapy. miR 409-3p overexpression sensitized the tumor to chemotherapy, while inhibiting chemotherapy-induced autophagy in a manner dependent on Beclin-1.

Rituximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

Investigative Drug(s) 1 drug(s) in total

Rituximab/Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Rituximab/Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

References

• Ref 1: MicroRNAs regulate key cell survival pathways and mediate chemosensitivity during progression of diffuse large B-cell lymphoma. Blood Cancer J. 2017 Dec 15;7(12):654. doi: 10.1038/s41408-017-0033-8.
• Ref 2: miR-409-3p sensitizes colon cancer cells to oxaliplatin by inhibiting Beclin-1-mediated autophagy. Int J Mol Med. 2016 Apr;37(4):1030-8. doi: 10.3892/ijmm.2016.2492. Epub 2016 Feb 18.