Molecule Information
General Information of the Molecule (ID: Mol01652)
| Name |
hsa-miR-409-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 409
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
GAAUGUUGCUCGGUGAACCCCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [2] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| FHC cells | Colon | Homo sapiens (Human) | CVCL_3688 | |
| DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| CCD-18Co cells | Colon | Homo sapiens (Human) | CVCL_2379 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The overexpression of miR 409-3p inhibited Beclin-1 expression and autophagic activity by binding to the 3'-untranslated region of Beclin-1 mRNA. In addition, the overexpression of miR 409-3p (+) the chemosensitivity of the oxaliplatin-sensitive and oxaliplatin-resistant colon cancer cells. The restoration of Beclin-1 abrogated these effects of miR 409-3p. In a xenograft model using nude mice, we examined the effects of miR 409-3p on tumor growth during chemotherapy. miR 409-3p overexpression sensitized the tumor to chemotherapy, while inhibiting chemotherapy-induced autophagy in a manner dependent on Beclin-1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Rituximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] | [3] | |||
| Resistant Disease | Papillary thyroid carcinoma [ICD-11: 2D10.1] | |||
| Resistant Drug | PLX4720 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
Immunoblot analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | This gene is up-regulated in PLX4720-resistance cells | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Rituximab/Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
