Molecule Information

General Information of the Molecule (ID: Mol01648)

• Name: hsa-miR-429 ,Homo sapiens
• Synonyms: microRNA 429
• Molecule Type: Mature miRNA
• Sequence: UAAUACUGUCUGGUAAAACCGU
• Ensembl ID: ENSG00000198976
• HGNC ID: HGNC:13784
• Mature Accession: MIMAT0001536

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Endometrial cancer [ICD-11: 2C76.1] [2]

• Resistant Disease: Endometrial cancer [ICD-11: 2C76.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [3]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [ICD-11: 2C25.5] [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [4]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
• Mechanism Description: Down-regulation of miR429 contributes to the development of drug resistance in epithelial ovarian cancer by targeting ZEB1.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Erlotinib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [7]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MEK-EGFR-PI3K signalling pathway; Regulation; N.A.
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [9]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR429 sensitized gemcitabine response in GZ-resistant pancreatic cancer cells via its direct upregulation of PDCD4 expression.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [3]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [ICD-11: 2C25.5] [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Clinical Trial Drug(s) 2 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [12]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

PD-0325901

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [7]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: PD-0325901
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MEK-EGFR-PI3K signalling pathway; Regulation; N.A.
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
• Ref 3: miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
• Ref 4: Downregulation of miR-429 contributes to the development of drug resistance in epithelial ovarian cancer by targeting ZEB1. Am J Transl Res. 2017 Mar 15;9(3):1357-1368. eCollection 2017.
• Ref 5: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 6: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 7: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 8: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 9: MicroRNA-429 sensitizes pancreatic cancer cells to gemcitabine through regulation of PDCD4. Am J Transl Res. 2017 Nov 15;9(11):5048-5055. eCollection 2017.
• Ref 10: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 11: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 12: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.