Molecule Information

General Information of the Molecule (ID: Mol01648)

• Name: hsa-miR-429 ,Homo sapiens
• Synonyms: microRNA 429
• Molecule Type: Mature miRNA
• Sequence: UAAUACUGUCUGGUAAAACCGU
• Ensembl ID: ENSG00000198976
• HGNC ID: HGNC:13784
• Mature Accession: MIMAT0001536

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [1]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Endometrial cancer [1]

• Resistant Disease: Endometrial cancer [ICD-11: 2C76.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Gastric adenocarcinoma [2]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [3]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
• Mechanism Description: Down-regulation of miR429 contributes to the development of drug resistance in epithelial ovarian cancer by targeting ZEB1.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR429 sensitized gemcitabine response in GZ-resistant pancreatic cancer cells via its direct upregulation of PDCD4 expression.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric adenocarcinoma [2]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

References

• Ref 1: A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
• Ref 2: miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
• Ref 3: Downregulation of miR-429 contributes to the development of drug resistance in epithelial ovarian cancer by targeting ZEB1. Am J Transl Res. 2017 Mar 15;9(3):1357-1368. eCollection 2017.
• Ref 4: MicroRNA-429 sensitizes pancreatic cancer cells to gemcitabine through regulation of PDCD4. Am J Transl Res. 2017 Nov 15;9(11):5048-5055. eCollection 2017.