Molecule Information
General Information of the Molecule (ID: Mol01637)
| Name |
hsa-miR-326
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 326
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CCUCUGGGCCCUUCCUCCAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The elevated levels of miR-326 in the mimics-transfected VP-16-resistant cell line, MCF-7/VP, downregulated MRP-1 expression and sensitized these cells to VP-16 and doxorubicin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The elevated levels of miR-326 in the mimics-transfected VP-16-resistant cell line, MCF-7/VP, downregulated MRP-1 expression and sensitized these cells to VP-16 and doxorubicin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR-326/NFIB axis | Regulation | N.A. | |
| In Vitro Model | NCM460 cells | Colon | Homo sapiens (Human) | CVCL_0460 |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| HCT-116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| In Vivo Model | Colorectal cancer tissue model; Nude mouse xenograft model | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR; Western blot; Dual-luciferase reporter assay | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry; Transwell assay; Wound healing assay | |||
| Mechanism Description | These data suggested that circ_0082182 elevated the NFIB expression to regulate OXA resistance and CRC progression by absorbing miR-326. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [4] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
| Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [4] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
| Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [5] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Curcumin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | SHH/GLI1 signaling pathway | Inhibition | hsa05217 | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR326 exerts a tumor inhibition effect by decreasing the activity of the SHH/GLI1 pathway. miR326 could target the SMO oncogene to inhibit the biological behaviors and stemness of glioma cells. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [4] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Celastrol | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
| Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
