General Information of the Molecule (ID: Mol01637)
Name
hsa-miR-326 ,Homo sapiens
Synonyms
microRNA 326
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CCUCUGGGCCCUUCCUCCAG
    Click to Show/Hide
Ensembl ID
ENSG00000199090
HGNC ID
HGNC:31769
Mature Accession
MIMAT0000756
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The elevated levels of miR-326 in the mimics-transfected VP-16-resistant cell line, MCF-7/VP, downregulated MRP-1 expression and sensitized these cells to VP-16 and doxorubicin.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The elevated levels of miR-326 in the mimics-transfected VP-16-resistant cell line, MCF-7/VP, downregulated MRP-1 expression and sensitized these cells to VP-16 and doxorubicin.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR-326/NFIB axis Regulation N.A.
In Vitro Model NCM460 cells Colon Homo sapiens (Human) CVCL_0460
SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT-116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Colorectal cancer tissue model; Nude mouse xenograft model Homo sapiens
Experiment for
Molecule Alteration
RT-qPCR; Western blot; Dual-luciferase reporter assay
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry; Transwell assay; Wound healing assay
Mechanism Description These data suggested that circ_0082182 elevated the NFIB expression to regulate OXA resistance and CRC progression by absorbing miR-326.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [4]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [4]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
Curcumin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [5]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Curcumin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation SHH/GLI1 signaling pathway Inhibition hsa05217
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR326 exerts a tumor inhibition effect by decreasing the activity of the SHH/GLI1 pathway. miR326 could target the SMO oncogene to inhibit the biological behaviors and stemness of glioma cells.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Celastrol
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [4]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Celastrol
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
References
Ref 1 MicroRNA 133a and microRNA 326 co contribute to hepatocellular carcinoma 5 fluorouracil and cisplatin sensitivity by directly targeting B cell lymphoma extra large. Mol Med Rep. 2015 Oct;12(4):6235-40. doi: 10.3892/mmr.2015.4134. Epub 2015 Jul 29.
Ref 2 Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
Ref 3 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 4 miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
Ref 5 MicroRNA-326 sensitizes human glioblastoma cells to curcumin via the SHH/GLI1 signaling pathway. Cancer Biol Ther. 2018 Apr 3;19(4):260-270. doi: 10.1080/15384047.2016.1250981. Epub 2018 Feb 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.