Molecule Information

General Information of the Molecule (ID: Mol01633)

• Name: hsa-miR-381-3p ,Homo sapiens
• Synonyms: microRNA 381
• Molecule Type: Mature miRNA
• Sequence: UAUACAAGGGCAAGCUCUCUGU
• Ensembl ID: ENSG00000199020
• HGNC ID: HGNC:31874
• Mature Accession: MIMAT0000736

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

Rituximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

Investigative Drug(s) 1 drug(s) in total

Rituximab/Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [1]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Rituximab/Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MAPK/BCR/PI signaling pathway; Regulation; hsa04662
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability assay
• Mechanism Description: miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.

References

• Ref 1: MicroRNAs regulate key cell survival pathways and mediate chemosensitivity during progression of diffuse large B-cell lymphoma. Blood Cancer J. 2017 Dec 15;7(12):654. doi: 10.1038/s41408-017-0033-8.