General Information of the Molecule (ID: Mol01633)
Name
hsa-miR-381-3p ,Homo sapiens
Synonyms
microRNA 381
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAUACAAGGGCAAGCUCUCUGU
    Click to Show/Hide
Ensembl ID
ENSG00000199020
HGNC ID
HGNC:31874
Mature Accession
MIMAT0000736
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation N.A.
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
Rituximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Rituximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation N.A.
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Rituximab/Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Rituximab/Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation N.A.
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
References
Ref 1 MicroRNAs regulate key cell survival pathways and mediate chemosensitivity during progression of diffuse large B-cell lymphoma. Blood Cancer J. 2017 Dec 15;7(12):654. doi: 10.1038/s41408-017-0033-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.