Molecule Information
General Information of the Molecule (ID: Mol01633)
| Name |
hsa-miR-381-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 381
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAUACAAGGGCAAGCUCUCUGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Rituximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Rituximab/Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | N.A. | |
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
| Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
