General Information of the Molecule (ID: Mol01630)
Name
hsa-miR-370-3p ,Homo sapiens
Synonyms
microRNA 370
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GCCUGCUGGGGUGGAACCUGGU
    Click to Show/Hide
Ensembl ID
ENSG00000199005
HGNC ID
HGNC:31784
Mature Accession
MIMAT0000722
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation hsa04662
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
Rituximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Rituximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation hsa04662
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
U87 cells Brain Homo sapiens (Human) CVCL_0022
U373 cells Brain Homo sapiens (Human) CVCL_2219
LN-18 cells Brain Homo sapiens (Human) CVCL_0392
T98G cells Brain Homo sapiens (Human) CVCL_0556
SHG-44 cells Brain Homo sapiens (Human) CVCL_6728
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
TMZ cytotoxicity assay; Colony formation assay; gamma -H2AX foci formation assay
Mechanism Description Up-regulation of miR370-3p restores glioblastoma multiforme sensitivity to temozolomide by influencing MGMT expression. MGMT was found to be inversely correlated with miR370-3p expression.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Rituximab/Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [1]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Rituximab/Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation MAPK/BCR/PI signaling pathway Regulation hsa04662
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Blue Cell Viability assay
Mechanism Description miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin.
References
Ref 1 MicroRNAs regulate key cell survival pathways and mediate chemosensitivity during progression of diffuse large B-cell lymphoma. Blood Cancer J. 2017 Dec 15;7(12):654. doi: 10.1038/s41408-017-0033-8.
Ref 2 Up-regulation of miR-370-3p restores glioblastoma multiforme sensitivity to temozolomide by influencing MGMT expression. Sci Rep. 2016 Sep 6;6:32972. doi: 10.1038/srep32972.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.