Molecule Information
General Information of the Molecule (ID: Mol01630)
Name |
hsa-miR-370-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 370
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GCCUGCUGGGGUGGAACCUGGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | hsa04662 | |
In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Sensitive Drug | Rituximab | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | hsa04662 | |
In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [2] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
U373 cells | Brain | Homo sapiens (Human) | CVCL_2219 | |
LN-18 cells | Brain | Homo sapiens (Human) | CVCL_0392 | |
T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
SHG-44 cells | Brain | Homo sapiens (Human) | CVCL_6728 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
TMZ cytotoxicity assay; Colony formation assay; gamma -H2AX foci formation assay | |||
Mechanism Description | Up-regulation of miR370-3p restores glioblastoma multiforme sensitivity to temozolomide by influencing MGMT expression. MGMT was found to be inversely correlated with miR370-3p expression. |
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Sensitive Drug | Rituximab/Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | MAPK/BCR/PI signaling pathway | Regulation | hsa04662 | |
In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CellTiter-Blue Cell Viability assay | |||
Mechanism Description | miR370-3p, miR381-3p, and miR409-3p miRNAs appear to be the most potent regulators of the MAPk, BCR, and PI signaling system. Overexpression of miR370-3p, miR381-3p, and miR409-3p increases sensitivity to rituximab and doxorubicin. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.