Molecule Information

General Information of the Molecule (ID: Mol01624)

• Name: hsa-miR-200a-3p ,Homo sapiens
• Synonyms: microRNA 200a
• Molecule Type: Mature miRNA
• Sequence: UAACACUGUCUGGUAACGAUGU
• Ensembl ID: ENSG00000207607
• HGNC ID: HGNC:31578
• Mature Accession: MIMAT0000682

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Ovarian cancer patients; Homo sapiens
• Experiment for Molecule Alteration: PD-L1 enzyme-linked immunosorbent assay; Immunohistochemistry; RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: High miR200 levels were related to high sPD-L1 levels (p=0.03), whilst high miR34a levels were associated with low sPD-L1 levels (p=0.02).As well as cancer cell expression of PD-L1, a high sPD-L1 level characterizes a subset of patients with ovarian cancer.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [3]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometric analysis; Colony forming assay
• Mechanism Description: miR200a-3p enhances anti-cancer drug resistance by decreasing DUSP6 expression.

References

• Ref 1: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 2: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 3: microRNA-200a-3p increases 5-fluorouracil resistance by regulating dual specificity phosphatase 6 expression. Exp Mol Med. 2017 May 12;49(5):e327. doi: 10.1038/emm.2017.33.