Molecule Information

General Information of the Molecule (ID: Mol01603)

• Name: hsa-miR-142-3p ,Homo sapiens
• Synonyms: microRNA 142
• Molecule Type: Mature miRNA
• Sequence: UGUAGUGUUUCCUACUUUAUGGA
• Ensembl ID: ENSG00000284353
• HGNC ID: HGNC:31529
• Mature Accession: MIMAT0000434

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Activation; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: 16HBE cells; Lung; Homo sapiens (Human); CVCL_0112
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 and TUNEL staining assay; MTT assay
• Mechanism Description: miR142-3p regulates starvation-induced autophagy of NSCLC cells by directly downregulating HMGB1 and subsequently activating the PI3k/Akt/mTOR pathway. miR142-3p overexpression inhibited anticancer drug-induced autophagy and increased chemo-sensitivity of NSCLC in vitro and in vivo.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Activation; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: 16HBE cells; Lung; Homo sapiens (Human); CVCL_0112
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 and TUNEL staining assay; MTT assay
• Mechanism Description: miR142-3p regulates starvation-induced autophagy of NSCLC cells by directly downregulating HMGB1 and subsequently activating the PI3k/Akt/mTOR pathway. miR142-3p overexpression inhibited anticancer drug-induced autophagy and increased chemo-sensitivity of NSCLC in vitro and in vivo.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [3]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vivo Model: HT-29 xenograft mouse model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Annexin V assay
• Mechanism Description: The miR-142-3p was markedly decreased in coloncancer specimens, in which it was negatively correlated withthe expression of CD133, Lgr5, and ABCG2. Transfection of miR-142-3p mimics in colon cancer cells downregulated cyclin D1expression, induced G1phase cell cycle arrest, and elevatedthe sensitivity of the cells to 5-fluorouracil. Furthermore,OCT4 suppressed miR-142-3p, and hypomethylation of theOCT4promoter was associated with a reduction in miR-142-3p.

Metformin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [4]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Metformin
• Molecule Alteration: Demethylation; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Wound-healing assay; Transwell assay
• Mechanism Description: Metformin inhibits the expression of MALAT1 and upregulates miR-142-3p in cervical cancer cells.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: MiR-142-3p Overexpression Increases Chemo-Sensitivity of NSCLC by Inhibiting HMGB1-Mediated Autophagy. Cell Physiol Biochem. 2017;41(4):1370-1382. doi: 10.1159/000467896. Epub 2017 Mar 16.
• Ref 3: MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000. doi: 10.1007/s00109-013-1037-x. Epub 2013 Apr 26.
• Ref 4: Metformin, a first-line drug for type 2 diabetes mellitus, disrupts the MALAT1/miR-142-3p sponge to decrease invasion and migration in cervical cancer cells. Eur J Pharmacol. 2018 Jul 5;830:59-67. doi: 10.1016/j.ejphar.2018.04.027. Epub 2018 Apr 25.