General Information of the Molecule (ID: Mol01603)
Name
hsa-miR-142-3p ,Homo sapiens
Synonyms
microRNA 142
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGUAGUGUUUCCUACUUUAUGGA
    Click to Show/Hide
Ensembl ID
ENSG00000284353
HGNC ID
HGNC:31529
Mature Accession
MIMAT0000434
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
16HBE cells Lung Homo sapiens (Human) CVCL_0112
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Caspase-3 and TUNEL staining assay; MTT assay
Mechanism Description miR142-3p regulates starvation-induced autophagy of NSCLC cells by directly downregulating HMGB1 and subsequently activating the PI3k/Akt/mTOR pathway. miR142-3p overexpression inhibited anticancer drug-induced autophagy and increased chemo-sensitivity of NSCLC in vitro and in vivo.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
16HBE cells Lung Homo sapiens (Human) CVCL_0112
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Caspase-3 and TUNEL staining assay; MTT assay
Mechanism Description miR142-3p regulates starvation-induced autophagy of NSCLC cells by directly downregulating HMGB1 and subsequently activating the PI3k/Akt/mTOR pathway. miR142-3p overexpression inhibited anticancer drug-induced autophagy and increased chemo-sensitivity of NSCLC in vitro and in vivo.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [3]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
In Vivo Model HT-29 xenograft mouse model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description The miR-142-3p was markedly decreased in coloncancer specimens, in which it was negatively correlated withthe expression of CD133, Lgr5, and ABCG2. Transfection of miR-142-3p mimics in colon cancer cells downregulated cyclin D1expression, induced G1phase cell cycle arrest, and elevatedthe sensitivity of the cells to 5-fluorouracil. Furthermore,OCT4 suppressed miR-142-3p, and hypomethylation of theOCT4promoter was associated with a reduction in miR-142-3p.
Metformin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [4]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Metformin
Molecule Alteration Demethylation
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Wound-healing assay; Transwell assay
Mechanism Description Metformin inhibits the expression of MALAT1 and upregulates miR-142-3p in cervical cancer cells.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 MiR-142-3p Overexpression Increases Chemo-Sensitivity of NSCLC by Inhibiting HMGB1-Mediated Autophagy. Cell Physiol Biochem. 2017;41(4):1370-1382. doi: 10.1159/000467896. Epub 2017 Mar 16.
Ref 3 MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000. doi: 10.1007/s00109-013-1037-x. Epub 2013 Apr 26.
Ref 4 Metformin, a first-line drug for type 2 diabetes mellitus, disrupts the MALAT1/miR-142-3p sponge to decrease invasion and migration in cervical cancer cells. Eur J Pharmacol. 2018 Jul 5;830:59-67. doi: 10.1016/j.ejphar.2018.04.027. Epub 2018 Apr 25.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.