General Information of the Molecule (ID: Mol01597)
Name
hsa-miR-130a-3p ,Homo sapiens
Synonyms
microRNA 130a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAGUGCAAUGUUAAAAGGGCAU
    Click to Show/Hide
Ensembl ID
ENSG00000208009
HGNC ID
HGNC:31514
Mature Accession
MIMAT0000425
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
BEAS-2B cells Bronchus Homo sapiens (Human) CVCL_0168
DDP-resistant NSCLC A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description LncRNA CCAT1/miR130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4. CCAT1 effectively acted as a miRNA sponge for miR130a-3p to enhance SOX4 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cells viability and apoptosis assays
Mechanism Description Results:We identified 11 specific deregulated miRNAs, including 5 up-regulated miRNAs (miR-155-5p, miR-21-3p, miR-181a-5p, miR-181b-5p, and miR-183-5p) and 6 down-regulated miRNAs (miR-10b-5p, miR-451a, miR-125b-5p, miR-31-5p, miR-195-5p and miR-130a-3p)
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Activation hsa04115
In Vitro Model KYSE-270 cells Esophagus Homo sapiens (Human) CVCL_1350
KYSE-410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [4]
Resistant Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CCLP-1 cells Liver Homo sapiens (Human) CVCL_0205
MzChA-1 cells Liver Homo sapiens (Human) CVCL_6932
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Transfection of miR130a-3p mimic suppressed the expression of PPARG and increased gemcitabine resistance.
References
Ref 1 LncRNA CCAT1/miR-130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4. Cancer Biol Ther. 2017 Dec 2;18(12):974-983. doi: 10.1080/15384047.2017.1385679. Epub 2017 Oct 11.
Ref 2 Complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. Sci Rep. 2018 Dec 3;8(1):17553. doi: 10.1038/s41598-018-35799-1.
Ref 3 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 4 Micro-RNA-130a-3p Regulates Gemcitabine Resistance via PPARG in Cholangiocarcinoma. Ann Surg Oncol. 2017 Aug;24(8):2344-2352. doi: 10.1245/s10434-017-5871-x. Epub 2017 May 30.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.