Molecule Information
General Information of the Molecule (ID: Mol01597)
| Name |
hsa-miR-130a-3p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 130a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAGUGCAAUGUUAAAAGGGCAU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| BEAS-2B cells | Bronchus | Homo sapiens (Human) | CVCL_0168 | |
| DDP-resistant NSCLC A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | LncRNA CCAT1/miR130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4. CCAT1 effectively acted as a miRNA sponge for miR130a-3p to enhance SOX4 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cells viability and apoptosis assays | |||
| Mechanism Description | Results:We identified 11 specific deregulated miRNAs, including 5 up-regulated miRNAs (miR-155-5p, miR-21-3p, miR-181a-5p, miR-181b-5p, and miR-183-5p) and 6 down-regulated miRNAs (miR-10b-5p, miR-451a, miR-125b-5p, miR-31-5p, miR-195-5p and miR-130a-3p) | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | p53 signaling pathway | Activation | hsa04115 | |
| In Vitro Model | KYSE-270 cells | Esophagus | Homo sapiens (Human) | CVCL_1350 |
| KYSE-410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] | [4] | |||
| Resistant Disease | Cholangiocarcinoma [ICD-11: 2C12.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | CCLP-1 cells | Liver | Homo sapiens (Human) | CVCL_0205 |
| MzChA-1 cells | Liver | Homo sapiens (Human) | CVCL_6932 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Transfection of miR130a-3p mimic suppressed the expression of PPARG and increased gemcitabine resistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
