Molecule Information

General Information of the Molecule (ID: Mol01597)

• Name: hsa-miR-130a-3p ,Homo sapiens
• Synonyms: microRNA 130a
• Molecule Type: Mature miRNA
• Sequence: CAGUGCAAUGUUAAAAGGGCAU
• Ensembl ID: ENSG00000208009
• HGNC ID: HGNC:31514
• Mature Accession: MIMAT0000425

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: BEAS-2B cells; Bronchus; Homo sapiens (Human); CVCL_0168
• In Vitro Model: DDP-resistant NSCLC A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA CCAT1/miR130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4. CCAT1 effectively acted as a miRNA sponge for miR130a-3p to enhance SOX4 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: KYSE-270 cells; Esophagus; Homo sapiens (Human); CVCL_1350
• In Vitro Model: KYSE-410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: KYSE-270 cells; Esophagus; Homo sapiens (Human); CVCL_1350
• In Vitro Model: KYSE-410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: KYSE-270 cells; Esophagus; Homo sapiens (Human); CVCL_1350
• In Vitro Model: KYSE-410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The effect of miR-130a-3p downregulation on enhancement of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the increase of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: KYSE-270 cells; Esophagus; Homo sapiens (Human); CVCL_1350
• In Vitro Model: KYSE-410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The effect of miR-130a-3p upregulation on suppression of protein levels was more pronounced for Bcl-2 compared to XIAP, whereas the inhibition of miR-130a-3p resulted in a more pronounced increase of protein levels of XIAP compared to Bcl-2. Both, up- and downregulation of miR-130a-3p and miR-148a-3p increased sensitivity towards chemotherapy in ESCC and complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cholangiocarcinoma [3]

• Resistant Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CCLP-1 cells; Liver; Homo sapiens (Human); CVCL_0205
• In Vitro Model: MzChA-1 cells; Liver; Homo sapiens (Human); CVCL_6932
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Transfection of miR130a-3p mimic suppressed the expression of PPARG and increased gemcitabine resistance.

References

• Ref 1: LncRNA CCAT1/miR-130a-3p axis increases cisplatin resistance in non-small-cell lung cancer cell line by targeting SOX4. Cancer Biol Ther. 2017 Dec 2;18(12):974-983. doi: 10.1080/15384047.2017.1385679. Epub 2017 Oct 11.
• Ref 2: Complex role of miR-130a-3p and miR-148a-3p balance on drug resistance and tumor biology in esophageal squamous cell carcinoma. Sci Rep. 2018 Dec 3;8(1):17553. doi: 10.1038/s41598-018-35799-1.
• Ref 3: Micro-RNA-130a-3p Regulates Gemcitabine Resistance via PPARG in Cholangiocarcinoma. Ann Surg Oncol. 2017 Aug;24(8):2344-2352. doi: 10.1245/s10434-017-5871-x. Epub 2017 May 30.