General Information of the Molecule (ID: Mol01596)
Name
hsa-miR-125b-5p ,Homo sapiens
Synonyms
microRNA 125b-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCCCUGAGACCCUAACUUGUGA
    Click to Show/Hide
Ensembl ID
ENSG00000207971
HGNC ID
HGNC:31506
Mature Accession
MIMAT0000423
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cutaneous T-cell lymphomas [1]
Resistant Disease Cutaneous T-cell lymphomas [ICD-11: 2B00.0]
Resistant Drug Bortezomib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model MyLa2000 cells Skin Homo sapiens (Human) CVCL_8328
SeAx cells Skin Homo sapiens (Human) CVCL_5363
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Bortezomib repressed cMyc and simultaneously induced miR-125b-5p that exerted a cytoprotective effect through the downmodulation of MAD4. miR-125b-5p can regulates tumor growth in vivo,and increases cellular resistance to proteasome inhibitors via modulation of MAD4.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gallbladder cancer [2]
Sensitive Disease Gallbladder cancer [ICD-11: 2C13.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR125b-5p/BCL2 signaling pathway Regulation hsa05206
In Vitro Model GBC-SD cells Gallbladder Homo sapiens (Human) CVCL_6903
NOZ cells Gallbladder Homo sapiens (Human) CVCL_3079
HEK293 FT cells Kidney Homo sapiens (Human) CVCL_6911
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Annexin V/PI Apoptosis Detection assay
Mechanism Description miR125b-5p enhances chemotherapy sensitivity to cisplatin by down-regulating Bcl2 in gallbladder cancer.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [3]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Resistant Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SU-DHL-2 cells Pleural effusion Homo sapiens (Human) CVCL_9550
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [3]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SU-DHL-2 cells Pleural effusion Homo sapiens (Human) CVCL_9550
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.
Prednisone
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [3]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Resistant Drug Prednisone
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SU-DHL-2 cells Pleural effusion Homo sapiens (Human) CVCL_9550
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.
Rituximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [3]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Resistant Drug Rituximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SU-DHL-2 cells Pleural effusion Homo sapiens (Human) CVCL_9550
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [3]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SU-DHL-2 cells Pleural effusion Homo sapiens (Human) CVCL_9550
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.
References
Ref 1 cMyc/miR-125b-5p signalling determines sensitivity to bortezomib in preclinical model of cutaneous T-cell lymphomas. PLoS One. 2013;8(3):e59390. doi: 10.1371/journal.pone.0059390. Epub 2013 Mar 19.
Ref 2 miR-125b-5p enhances chemotherapy sensitivity to cisplatin by down-regulating Bcl2 in gallbladder cancer. Sci Rep. 2017 Mar 3;7:43109. doi: 10.1038/srep43109.
Ref 3 Exosome-derived miRNAs as predictive biomarkers for diffuse large B-cell lymphoma chemotherapy resistance. Epigenomics. 2019 Jan;11(1):35-51. doi: 10.2217/epi-2018-0123. Epub 2018 Sep 13.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.