Molecule Information

General Information of the Molecule (ID: Mol01596)

• Name: hsa-miR-125b-5p ,Homo sapiens
• Synonyms: microRNA 125b-1
• Molecule Type: Mature miRNA
• Sequence: UCCCUGAGACCCUAACUUGUGA
• Ensembl ID: ENSG00000207971
• HGNC ID: HGNC:31506
• Mature Accession: MIMAT0000423

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Bortezomib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cutaneous T-cell lymphomas [1]

• Resistant Disease: Cutaneous T-cell lymphomas [ICD-11: 2B00.0]
• Resistant Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MyLa2000 cells; Skin; Homo sapiens (Human); CVCL_8328
• In Vitro Model: SeAx cells; Skin; Homo sapiens (Human); CVCL_5363
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Bortezomib repressed cMyc and simultaneously induced miR-125b-5p that exerted a cytoprotective effect through the downmodulation of MAD4. miR-125b-5p can regulates tumor growth in vivo,and increases cellular resistance to proteasome inhibitors via modulation of MAD4.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gallbladder cancer [2]

• Sensitive Disease: Gallbladder cancer [ICD-11: 2C13.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR125b-5p/BCL2 signaling pathway; Regulation; hsa05206
• In Vitro Model: GBC-SD cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: NOZ cells; Gallbladder; Homo sapiens (Human); CVCL_3079
• In Vitro Model: HEK293 FT cells; Kidney; Homo sapiens (Human); CVCL_6911
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay; Annexin V/PI Apoptosis Detection assay
• Mechanism Description: miR125b-5p enhances chemotherapy sensitivity to cisplatin by down-regulating Bcl2 in gallbladder cancer.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Rituximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

References

• Ref 1: cMyc/miR-125b-5p signalling determines sensitivity to bortezomib in preclinical model of cutaneous T-cell lymphomas. PLoS One. 2013;8(3):e59390. doi: 10.1371/journal.pone.0059390. Epub 2013 Mar 19.
• Ref 2: miR-125b-5p enhances chemotherapy sensitivity to cisplatin by down-regulating Bcl2 in gallbladder cancer. Sci Rep. 2017 Mar 3;7:43109. doi: 10.1038/srep43109.
• Ref 3: Exosome-derived miRNAs as predictive biomarkers for diffuse large B-cell lymphoma chemotherapy resistance. Epigenomics. 2019 Jan;11(1):35-51. doi: 10.2217/epi-2018-0123. Epub 2018 Sep 13.