General Information of the Molecule (ID: Mol01593)
Name
hsa-miR-23b-3p ,Homo sapiens
Synonyms
microRNA 23b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AUCACAUUGCCAGGGAUUACCAC
    Click to Show/Hide
Ensembl ID
ENSG00000207563
HGNC ID
HGNC:31606
Mature Accession
MIMAT0000418
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration
RT-PCR; Luciferase reporter assay; Pull down assay
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model SCID-SHO mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration
RT-PCR; Luciferase reporter assay; Pull down assay
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model SCID-SHO mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
Microarray analyses; Luciferase reporter assay; Western blot
Experiment for
Drug Resistance
Cell proliferation assays; MTT assay
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration
RT-PCR; Luciferase reporter assay; Pull down assay
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model SCID-SHO mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [3]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Resistant Drug PLX4720
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description This gene is up-regulated in PLX4720-resistance cells
References
Ref 1 Long noncoding RNA MALAT1 regulates autophagy associated chemoresistance via miR-23b-3p sequestration in gastric cancer. Mol Cancer. 2017 Nov 21;16(1):174. doi: 10.1186/s12943-017-0743-3.
Ref 2 miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 2015 May 21;6(5):e1766. doi: 10.1038/cddis.2015.123.
Ref 3 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.