Molecule Information

General Information of the Molecule (ID: Mol01593)

• Name: hsa-miR-23b-3p ,Homo sapiens
• Synonyms: microRNA 23b
• Molecule Type: Mature miRNA
• Sequence: AUCACAUUGCCAGGGAUUACCAC
• Ensembl ID: ENSG00000207563
• HGNC ID: HGNC:31606
• Mature Accession: MIMAT0000418

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: RT-PCR; Luciferase reporter assay; Pull down assay
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: SCID-SHO mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: RT-PCR; Luciferase reporter assay; Pull down assay
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: SCID-SHO mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: Microarray analyses; Luciferase reporter assay; Western blot
• Experiment for Drug Resistance: Cell proliferation assays; MTT assay

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: RT-PCR; Luciferase reporter assay; Pull down assay
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: MALAT1 acts as a competing endogenous RNA for miR23b-3p and attenuates the inhibitory effect of miR23b-3p on ATG12, leading to chemo-induced autophagy and chemoresistance in GC cells. MALAT1 promotes autophagy-associated chemoresistance of GC cells via sequestration of miR23b-3p.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR23b-3p/ATG12/HMGB2/autophagy regulatory loop signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: SCID-SHO mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ATG12 and HMGB2 were the direct targets of miR-23b-3p. Meanwhile, ATG12 and HMGB2 were positively associated with the occurrence of autophagy. Reducing the expression of these target genes by siRNA or inhibition of autophagy both sensitized GC cells to chemotherapy. These findings suggest that a miR-23b-3p/ATG12/HMGB2/autophagy-regulatory loop has a critical role in MDR in GC. In addition, miR-23b-3p could be used as a prognostic factor for overall survival in GC. miR-23b-3p inhibited autophagy mediated by ATG12 and HMGB2 and sensitized GC cells to chemotherapy, and suggested the potential application of miR-23b-3p in drug resistance prediction and treatment.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [3]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: Long noncoding RNA MALAT1 regulates autophagy associated chemoresistance via miR-23b-3p sequestration in gastric cancer. Mol Cancer. 2017 Nov 21;16(1):174. doi: 10.1186/s12943-017-0743-3.
• Ref 2: miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 2015 May 21;6(5):e1766. doi: 10.1038/cddis.2015.123.
• Ref 3: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.