Molecule Information
General Information of the Molecule (ID: Mol01586)
| Name |
hsa-miR-218-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 218-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUGUGCUUGAUCUAACCAUGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gallbladder cancer [ICD-11: 2C13.0] | [1] | |||
| Sensitive Disease | Gallbladder cancer [ICD-11: 2C13.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | PRKCE/MDR1 signaling pathway | Inhibition | hsa05206 | |
| In Vitro Model | GBC-SD cells | Gallbladder | Homo sapiens (Human) | CVCL_6903 |
| NOZ cells | Gallbladder | Homo sapiens (Human) | CVCL_3079 | |
| SGC-996 cells | Gallbladder | Homo sapiens (Human) | CVCL_M737 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Annexin V assay | |||
| Mechanism Description | miR218-5p restores sensitivity to gemcitabine through PRkCE/MDR1 axis in gallbladder cancer, miR218-5p promotes sensitivity of gemcitabine by abolishing PRkCE-induced upregulation of MDR1/P-gp. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
