Molecule Information
General Information of the Molecule (ID: Mol01579)
| Name |
hsa-miR-183-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 183
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UAUGGCACUGGUAGAAUUCACU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] | [1] | |||
| Resistant Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] | [1] | |||
| Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | CircPAN3 mediates drug resistance in acute myeloid leukemia through the miR-153-5p/miR-183-5p-XIAP axis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
