General Information of the Molecule (ID: Mol01576)
Name
hsa-miR-181b-5p ,Homo sapiens
Synonyms
microRNA 181b-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACAUUCAUUGCUGUCGGUGGGU
    Click to Show/Hide
Ensembl ID
ENSG00000207975
HGNC ID
HGNC:31550
Mature Accession
MIMAT0000257
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [1]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; Transwell assay
Mechanism Description Upregulation of miR-181b-5p targets Bcl-2 directly and may function as an important modifier to sensitize glioma cells to TMZ.
References
Ref 1 MiR-181b-5p modulates chemosensitivity of glioma cells to temozolomide by targeting Bcl-2. Biomed Pharmacother. 2019 Jan;109:2192-2202. doi: 10.1016/j.biopha.2018.11.074. Epub 2018 Nov 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.