Molecule Information

General Information of the Molecule (ID: Mol01576)

• Name: hsa-miR-181b-5p ,Homo sapiens
• Synonyms: microRNA 181b-1
• Molecule Type: Mature miRNA
• Sequence: AACAUUCAUUGCUGUCGGUGGGU
• Ensembl ID: ENSG00000207975
• HGNC ID: HGNC:31550
• Mature Accession: MIMAT0000257

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [1]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Transwell assay
• Mechanism Description: Upregulation of miR-181b-5p targets Bcl-2 directly and may function as an important modifier to sensitize glioma cells to TMZ.

References

• Ref 1: MiR-181b-5p modulates chemosensitivity of glioma cells to temozolomide by targeting Bcl-2. Biomed Pharmacother. 2019 Jan;109:2192-2202. doi: 10.1016/j.biopha.2018.11.074. Epub 2018 Nov 27.