Molecule Information
General Information of the Molecule (ID: Mol01572)
Name |
hsa-miR-7-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 7-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGGAAGACUAGUGAUUUUGUUGUU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [1] | |||
Resistant Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | There was a protective role of miR-7-5p in cervical cancer cells treated with cisplatin and that miR-7-5p expression.miR-7-5p reduced energy consumption via inhibiting PARP-1 expression, and miR-7-5p increased energy generation by suppressing the expression of Bcl-2. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [2] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
Cell viability | Activation | hsa05200 | ||
miR7-5p/ABCC1 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Overexpression of kCNQ1OT1 enhances OXA resistance through downregulating miR-7-5p and upregulating ABCC1 in HCC cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [3] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell colony | Inhibition | hsa05200 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-7-5p suppresses stemness and enhances temozolomide sensitivity of drug-resistant glioblastoma cells by targeting Yin Yang 1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.