Molecule Information

General Information of the Molecule (ID: Mol01572)

• Name: hsa-miR-7-5p ,Homo sapiens
• Synonyms: microRNA 7-1
• Molecule Type: Mature miRNA
• Sequence: UGGAAGACUAGUGAUUUUGUUGUU
• Ensembl ID: ENSG00000284179
• HGNC ID: HGNC:31638
• Mature Accession: MIMAT0000252

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [1]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: There was a protective role of miR-7-5p in cervical cancer cells treated with cisplatin and that miR-7-5p expression.miR-7-5p reduced energy consumption via inhibiting PARP-1 expression, and miR-7-5p increased energy generation by suppressing the expression of Bcl-2.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: MiRNA microarray analyses, qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [3]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: miR7-5p/ABCC1 signaling pathway; Regulation; N.A.
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of kCNQ1OT1 enhances OXA resistance through downregulating miR-7-5p and upregulating ABCC1 in HCC cells.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [4]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-7-5p suppresses stemness and enhances temozolomide sensitivity of drug-resistant glioblastoma cells by targeting Yin Yang 1.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: MiRNA microarray analyses, qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [5]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is down-regulated in PLX4720-resistance cells

References

• Ref 1: MicroRNA-7-5p Promotes Cisplatin Resistance of Cervical Cancer Cells and Modulation of Cellular Energy Homeostasis by Regulating the Expression of the PARP-1 and BCL2 Genes. Med Sci Monit. 2018 Sep 16;24:6506-6516. doi: 10.12659/MSM.910969.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: Long non-coding RNA KCNQ1OT1 modulates oxaliplatin resistance in hepatocellular carcinoma through miR-7-5p/ ABCC1 axis. Biochem Biophys Res Commun. 2018 Sep 18;503(4):2400-2406. doi: 10.1016/j.bbrc.2018.06.168. Epub 2018 Jul 4.
• Ref 4: MiR-7-5p suppresses stemness and enhances temozolomide sensitivity of drug-resistant glioblastoma cells by targeting Yin Yang 1. Exp Cell Res. 2019 Feb 1;375(1):73-81. doi: 10.1016/j.yexcr.2018.12.016. Epub 2018 Dec 23.
• Ref 5: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.