Molecule Information

General Information of the Molecule (ID: Mol01572)

• Name: hsa-miR-7-5p ,Homo sapiens
• Synonyms: microRNA 7-1
• Molecule Type: Mature miRNA
• Sequence: UGGAAGACUAGUGAUUUUGUUGUU
• Ensembl ID: ENSG00000284179
• HGNC ID: HGNC:31638
• Mature Accession: MIMAT0000252

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [1]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: There was a protective role of miR-7-5p in cervical cancer cells treated with cisplatin and that miR-7-5p expression.miR-7-5p reduced energy consumption via inhibiting PARP-1 expression, and miR-7-5p increased energy generation by suppressing the expression of Bcl-2.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: miR7-5p/ABCC1 signaling pathway; Regulation; N.A.
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of kCNQ1OT1 enhances OXA resistance through downregulating miR-7-5p and upregulating ABCC1 in HCC cells.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [3]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-7-5p suppresses stemness and enhances temozolomide sensitivity of drug-resistant glioblastoma cells by targeting Yin Yang 1.

References

• Ref 1: MicroRNA-7-5p Promotes Cisplatin Resistance of Cervical Cancer Cells and Modulation of Cellular Energy Homeostasis by Regulating the Expression of the PARP-1 and BCL2 Genes. Med Sci Monit. 2018 Sep 16;24:6506-6516. doi: 10.12659/MSM.910969.
• Ref 2: Long non-coding RNA KCNQ1OT1 modulates oxaliplatin resistance in hepatocellular carcinoma through miR-7-5p/ ABCC1 axis. Biochem Biophys Res Commun. 2018 Sep 18;503(4):2400-2406. doi: 10.1016/j.bbrc.2018.06.168. Epub 2018 Jul 4.
• Ref 3: MiR-7-5p suppresses stemness and enhances temozolomide sensitivity of drug-resistant glioblastoma cells by targeting Yin Yang 1. Exp Cell Res. 2019 Feb 1;375(1):73-81. doi: 10.1016/j.yexcr.2018.12.016. Epub 2018 Dec 23.