Molecule Information
General Information of the Molecule (ID: Mol01567)
Name |
hsa-miR-199a-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 199a-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
ACAGUAGUCUGCACAUUGGUUA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
G-292 cells | Bone | Homo sapiens (Human) | CVCL_2909 | |
MNNG/HOS cells | Bone | Homo sapiens (Human) | CVCL_0439 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [2] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | miR199a/DDR1 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HO8910 cells | Ovary | Homo sapiens (Human) | CVCL_6868 | |
IOSE386 cells | Ovary | Homo sapiens (Human) | CVCL_E230 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis; Wound healing assay | |||
Mechanism Description | Suppressing miR199a-3p by promoter methylation contributes to tumor aggressiveness and cisplatin resistance of ovarian cancer through promoting DDR1 expression. Overexpression of miR199a-3p significantly impaired the migratory, invasive, and tumorigenic capabilities of ovarian cancer cells as well as enhanced cisplatin resistance through inhibiting DDR1 expression. | |||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
G-292 cells | Bone | Homo sapiens (Human) | CVCL_2909 | |
MNNG/HOS cells | Bone | Homo sapiens (Human) | CVCL_0439 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cholangiocarcinoma | [3] | |||
Sensitive Disease | Cholangiocarcinoma [ICD-11: 2C12.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | mTOR signaling pathway | Inhibition | hsa04150 | |
In Vitro Model | GBC-SD cells | Gallbladder | Homo sapiens (Human) | CVCL_6903 |
RBE cells | Liver | Homo sapiens (Human) | CVCL_4896 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | miR199a-3p enhances cisplatin sensitivity of cholangiocarcinoma cells by inhibiting mTOR signaling pathway and expression of MDR1. miR199a-3p overexpression could reduce cisplatin induced MDR1 expression by decreasing the synthesis and increasing the degradation of MDR1, thus enhancing the effectiveness of cisplatin in cholangiocarcinoma. | |||
Disease Class: Breast cancer | [4] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
MDA-MB-231/DDP cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
Mechanism Description | miR199a-3p enhances breast cancer cell sensitivity to cisplatin by downregulating TFAM. | |||
Disease Class: Ovarian cancer | [5] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Transwell assay; Flow cytometry assay | |||
Mechanism Description | miR-199a-3p enhances CDDP sensitivity of ovarian cancer cells through downregulating ITGB8 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [6] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | MDA-MB-231cells | Breast | Homo sapiens (Human) | CVCL_0062 |
MT-1 cells | Breast | Homo sapiens (Human) | CVCL_0441 | |
YPEN-1 cells | Breast | Homo sapiens (Human) | CVCL_0587 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Remarkably, miR-199a-3p inhibited both endogenous caveolin-2 activity and exogenous caveolin-2 activity, which was confirmed by a reporter construct bearing the 3'-untranslated region of caveolin-2. However, overexpression of caveolin-2 completely counteracted the enhancement of miR-199a-3p-mediated activities on cell proliferation, survival and sensitivity of tumor cells to anticancer drugs. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
G-292 cells | Bone | Homo sapiens (Human) | CVCL_2909 | |
MNNG/HOS cells | Bone | Homo sapiens (Human) | CVCL_0439 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The Ak4 gene is one of the targets of miR-199a-3p and negatively correlates with the effect of miR-199a-3p on OS drug-resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [7] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
KHOS cells | Bone | Homo sapiens (Human) | CVCL_2546 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | CD44 was overexpressed in metastatic and recurrent osteosarcoma as compared with primary tumors. Higher expression of CD44 was found in both patients with shorter survival and patients who exhibited unfavorable response to chemotherapy before surgical resection. Additionally, the 3'-untranslated region of CD44 mRNA was the direct target of microRNA-199a-3p (miR-199a-3p). Overexpression of miR-199a-3p significantly inhibited CD44 expression in osteosarcoma cells. miR-199a-3p is One of the most dramatically decreased miRs in osteosarcoma cells and tumor tissues as compared with normal osteoblast cells. Transfection of miR-199a-3p significantly increased the drug sensitivity through down-regulation of CD44 in osteosarcoma cells. Taken together, these results suggest that the CD44-miR-199a-3p axis plays an important role in the development of metastasis, recurrence, and drug resistance of osteosarcoma. Developing strategies to target CD44 may improve the clinical outcome of osteosarcoma. | |||
Disease Class: Hepatocellular carcinoma | [8] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
HLE cells | Liver | Homo sapiens (Human) | CVCL_1281 | |
HLF cells | Liver | Homo sapiens (Human) | CVCL_2947 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | There is an inverse correlation between the expression of miR-199a-3p and CD44 protein. Transfection of miR-199a-3p into SNU449 cells reduced in vitro invasion and sensitized the cells to doxorubicin. Inhibition of CD44 in CD44+ HCC cell lines using antisense oligonucleotides increased apoptosis, enhanced chemosensitivity, reduced tumorigensis and invasion. | |||
Disease Class: Hepatocellular cancer | [9] | |||
Sensitive Disease | Hepatocellular cancer [ICD-11: 2C12.4] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
SNU475 cells | Liver | Homo sapiens (Human) | CVCL_0497 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Cell invasion assay | |||
Mechanism Description | The mTOR pathway is activated by multiple extracellular signals, such as growth factors, nutrients, amino acids, hormones, and mitogens leading to the phosphorylation of the translational regulator, phospho-p70S6 kinase, which, in turn, regulates cell proliferation, regulates protein synthesis, and allows progression from the G1 to the S phase of the cell cycle. There is an inverse correlation linking miR-199a-3p and mTOR. miR-199a-3p restoration blocks the G1-S transition of the cell cycle, impairs invasion capability, and sensitizes HCC cells to doxorubicin challenge. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.