Molecule Information
General Information of the Molecule (ID: Mol01562)
| Name |
hsa-miR-107
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 107
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AGCAGCAUUGUACAGGGCUAUCA
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The A549 cells transfected with miR-107 mimics were significantly more sensitive to the therapy of cisplatin than control cells. A549 cells Transfected with miR-107 mimics showed a decreased CDk8 protein expression. Down-regulation of CDk8 expression by siRNAs, A549 cells became more sensitive to the therapy of cisplatin. In addition, the (+) growth-inhibitory effect by the miR-107 mimic transfection was (+) after the addition of CDk8 siRNA. The present study provides the first evidence that miR-107 plays a key role in cisplatin resistance by targeting the CDk8 protein in NSCLC cell lines, suggesting that miR-107 can be used to predict a patient's response to chemotherapy as well as serve as a novel potential maker for NSCLC therapy. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [2] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Lin28/miR107 pathway | Regulation | N.A. | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [2] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Lin28/miR107 pathway | Regulation | N.A. | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | [4] | |||
| Resistant Disease | Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | GIST882 cells | Gastric | Homo sapiens (Human) | CVCL_7044 |
| GIST48 cells | Gastric | Homo sapiens (Human) | CVCL_7041 | |
| In Vivo Model | GIST patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR; Western blot | |||
| Experiment for Drug Resistance |
Cytotoxicity assay | |||
| Mechanism Description | Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [5] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Olaparib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Experiment for Molecule Alteration |
Immunofluorescence; Western blot; RT-PCR; Luciferase assay | |||
| Experiment for Drug Resistance |
HR assay; Cell cycle analysis; Survival assay | |||
| Mechanism Description | Subsequent study focused on two of the strongest candidates, miR-103 and miR-107, as they are frequently deregulated in cancer | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Lin28/miR107 pathway | Regulation | N.A. | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-107 could enhance PTX sensitivity in breast cancer cells may be targeting TPD52 through Wnt/beta-catenin signaling pathway. And downregualtion of miR-107 ould enhance PTX resistance in BC cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [7] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis; Caspase-3 activity assay | |||
| Mechanism Description | Overexpression of miR107 promotes apoptosis and inhibits proliferation and mobility of A549/Taxol cells under treatment with paclitaxel in vitro. miR107/Bcl-w axis regulates paclitaxel chemoresistance through PI3k-Akt pathway, up-regulation of miR107 resensitizes paclitaxel-resistant NSCLC cells by targeting Bcl-w. Aberrant activation of PI3k-Akt pathway and genetic alterations of its components lead to tumorigenesis. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Lin28/miR107 pathway | Regulation | N.A. | ||
| In Vitro Model | MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 |
| MkN28 cells | Gastric | Homo sapiens (Human) | CVCL_1416 | |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [8] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
Clinical Trial Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [2] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PEO1 C4-2 cells | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Survival assay/crystal violet staining assay | |||
| Mechanism Description | miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [9] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Parthenolide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
SRB assay; BrdU assay | |||
| Mechanism Description | microRNA-107 targets IkBkG and sensitizes A549 cells to parthenolide. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
