General Information of the Molecule (ID: Mol01562)
Name
hsa-miR-107 ,Homo sapiens
Synonyms
microRNA 107
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGCAGCAUUGUACAGGGCUAUCA
    Click to Show/Hide
Ensembl ID
ENSG00000198997
HGNC ID
HGNC:31496
Mature Accession
MIMAT0000104
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The A549 cells transfected with miR-107 mimics were significantly more sensitive to the therapy of cisplatin than control cells. A549 cells Transfected with miR-107 mimics showed a decreased CDk8 protein expression. Down-regulation of CDk8 expression by siRNAs, A549 cells became more sensitive to the therapy of cisplatin. In addition, the (+) growth-inhibitory effect by the miR-107 mimic transfection was (+) after the addition of CDk8 siRNA. The present study provides the first evidence that miR-107 plays a key role in cisplatin resistance by targeting the CDk8 protein in NSCLC cell lines, suggesting that miR-107 can be used to predict a patient's response to chemotherapy as well as serve as a novel potential maker for NSCLC therapy.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Lin28/miR107 pathway Regulation N.A.
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Lin28/miR107 pathway Regulation N.A.
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [4]
Resistant Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model GIST882 cells Gastric Homo sapiens (Human) CVCL_7044
GIST48 cells Gastric Homo sapiens (Human) CVCL_7041
In Vivo Model GIST patients Homo sapiens
Experiment for
Molecule Alteration
RT-qPCR; Western blot
Experiment for
Drug Resistance
Cytotoxicity assay
Mechanism Description Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment.
Olaparib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [5]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Olaparib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
Immunofluorescence; Western blot; RT-PCR; Luciferase assay
Experiment for
Drug Resistance
HR assay; Cell cycle analysis; Survival assay
Mechanism Description Subsequent study focused on two of the strongest candidates, miR-103 and miR-107, as they are frequently deregulated in cancer
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Lin28/miR107 pathway Regulation N.A.
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell apoptosis Inhibition hsa04210
Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-107 could enhance PTX sensitivity in breast cancer cells may be targeting TPD52 through Wnt/beta-catenin signaling pathway. And downregualtion of miR-107 ould enhance PTX resistance in BC cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [7]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis; Caspase-3 activity assay
Mechanism Description Overexpression of miR107 promotes apoptosis and inhibits proliferation and mobility of A549/Taxol cells under treatment with paclitaxel in vitro. miR107/Bcl-w axis regulates paclitaxel chemoresistance through PI3k-Akt pathway, up-regulation of miR107 resensitizes paclitaxel-resistant NSCLC cells by targeting Bcl-w. Aberrant activation of PI3k-Akt pathway and genetic alterations of its components lead to tumorigenesis.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Lin28/miR107 pathway Regulation N.A.
In Vitro Model MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
MkN28 cells Gastric Homo sapiens (Human) CVCL_1416
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Lin28 could inhibit the expression of miR-107, thereby up-regulating C-myc, P-gp and down-regulating Cyclin D1, subsequently result in chemo-resistance of gastric cancer cells. The Lin28/miR-107 pathway might be served as one of many signaling pathways that is associated with gastric cancer chemo-resistance.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Clinical Trial Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Camptothecin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Camptothecin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PEO1 C4-2 cells Ovary Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Survival assay/crystal violet staining assay
Mechanism Description miR-103 and miR-107 reduced homology-directed repair and sensitized cells to various DNA damaging agents, including cisplatin and a PARP inhibitor. Mechanistic analyses revealed that both miR-103 and miR-107 directly target and regulate RAD51 and RAD51D, which is critical for miR-103/107-mediated chemosensitization.
Parthenolide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [9]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Parthenolide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
SRB assay; BrdU assay
Mechanism Description microRNA-107 targets IkBkG and sensitizes A549 cells to parthenolide.
References
Ref 1 miR-107 regulates cisplatin chemosensitivity of A549 non small cell lung cancer cell line by targeting cyclin dependent kinase 8. Int J Clin Exp Pathol. 2014 Sep 15;7(10):7236-41. eCollection 2014.
Ref 2 Systematic screen identifies miRNAs that target RAD51 and RAD51D to enhance chemosensitivity. Mol Cancer Res. 2013 Dec;11(12):1564-73. doi: 10.1158/1541-7786.MCR-13-0292. Epub 2013 Oct 2.
Ref 3 Overexpression of Lin28 Decreases the Chemosensitivity of Gastric Cancer Cells to Oxaliplatin, Paclitaxel, Doxorubicin, and Fluorouracil in Part via microRNA-107. PLoS One. 2015 Dec 4;10(12):e0143716. doi: 10.1371/journal.pone.0143716. eCollection 2015.
Ref 4 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 5 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 6 miR-107 Enhances the Sensitivity of Breast Cancer Cells to Paclitaxel. Open Med (Wars). 2019 Jun 1;14:456-466. doi: 10.1515/med-2019-0049. eCollection 2019.
Ref 7 MiRNA-107 enhances chemosensitivity to paclitaxel by targeting antiapoptotic factor Bcl-w in non small cell lung cancer. Am J Cancer Res. 2017 Sep 1;7(9):1863-1873. eCollection 2017.
Ref 8 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 9 MicroRNA-107 Targets IKBKG and Sensitizes A549 Cells to Parthenolide. Anticancer Res. 2018 Nov;38(11):6309-6316. doi: 10.21873/anticanres.12987.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.