Molecule Information
General Information of the Molecule (ID: Mol01558)
Name |
hsa-miR-99a-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 99a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACCCGUAGAUCCGAUCUUGUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Cyclophosphamide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Prednisone | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Rituximab | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [1] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.