Molecule Information
General Information of the Molecule (ID: Mol01558)
| Name |
hsa-miR-99a-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 99a
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
AACCCGUAGAUCCGAUCUUGUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Cyclophosphamide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Prednisone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Rituximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [1] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SU-DHL-2 cells | Pleural effusion | Homo sapiens (Human) | CVCL_9550 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] | [2] | |||
| Resistant Disease | Papillary thyroid carcinoma [ICD-11: 2D10.1] | |||
| Resistant Drug | PLX4720 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
Immunoblot analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | This gene is up-regulated in PLX4720-resistance cells | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
