Molecule Information

General Information of the Molecule (ID: Mol01558)

• Name: hsa-miR-99a-5p ,Homo sapiens
• Synonyms: microRNA 99a
• Molecule Type: Mature miRNA
• Sequence: AACCCGUAGAUCCGAUCUUGUG
• Ensembl ID: ENSG00000207638
• HGNC ID: HGNC:31650
• Mature Accession: MIMAT0000097

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Rituximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

References

• Ref 1: Exosome-derived miRNAs as predictive biomarkers for diffuse large B-cell lymphoma chemotherapy resistance. Epigenomics. 2019 Jan;11(1):35-51. doi: 10.2217/epi-2018-0123. Epub 2018 Sep 13.