Molecule Information

General Information of the Molecule (ID: Mol01558)

• Name: hsa-miR-99a-5p ,Homo sapiens
• Synonyms: microRNA 99a
• Molecule Type: Mature miRNA
• Sequence: AACCCGUAGAUCCGAUCUUGUG
• Ensembl ID: ENSG00000207638
• HGNC ID: HGNC:31650
• Mature Accession: MIMAT0000097

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Rituximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [1]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SU-DHL-2 cells; Pleural effusion; Homo sapiens (Human); CVCL_9550
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression levels of exosomal miR-99a-5p/miR-125b-5p & their correlation with clinicopathological features in DLBCL patients, the expression levels of miR-99a-5p and miR-125b-5p were significantly higher in the chemoresistant group than in the chemosensitive group.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [2]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: Exosome-derived miRNAs as predictive biomarkers for diffuse large B-cell lymphoma chemotherapy resistance. Epigenomics. 2019 Jan;11(1):35-51. doi: 10.2217/epi-2018-0123. Epub 2018 Sep 13.
• Ref 2: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.