Molecule Information

General Information of the Molecule (ID: Mol01555)

• Name: hsa-miR-33a-5p ,Homo sapiens
• Synonyms: microRNA 33a
• Molecule Type: Mature miRNA
• Sequence: GUGCAUUGUAGUUGCAUUGCA
• Ensembl ID: ENSG00000207932
• HGNC ID: HGNC:31634
• Mature Accession: MIMAT0000091

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: MHCC97-L cells; Liver; Homo sapiens (Human); CVCL_4973
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: HSPA8 was the direct downstream target gene for miR33a-mediated drug resistance. Inhibition of miR33a-5p expression reduced cisplatin sensitivity in Hep3B and 97L and increased their drug resistance.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Triple negative breast cancer [ICD-11: 2C60.2] [2]

• Sensitive Disease: Triple negative breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The results indicated that miR-33a-5p expression was lower in TNBC cells compared with non-TNBC cells. miR-33a-5p overexpression significantly improved the doxorubicin (Dox) sensitivity of TNBC cells, but not that of non-TNBC cells. It was then observed that Dox treatment inhibited miR-33a-5p expression and induced EMT in TNBC cells, by increasing the expression levels of vimentin, while decreasing the expression levels of E-cadherin. Furthermore, it was revealed that forced expression of miR-33a-5p attenuated Dox-induced EMT. eIF5A2 was identified as a potential target of miR-33a-5p, and miR-33a-5p overexpression inhibited the expression of eIF5A2. eIF5A2 inhibition, via its inhibitor GC7, sensitized TNBC cells to Dox and reversed Dox-induced EMT. Overall, the present study demonstrated that miR-33a-5p enhanced the sensitivity of TNBC cells to Dox, by suppressing eIF5A2 expression and reversing Dox-induced EMT, providing a potential therapeutic target for treating drug-resistant TNBC.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.0] [2]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Pancreatic cancer patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Indeed, our results showed that gemcitabine treatment in sensitive MIA PaCa-2 cells caused a reduction in intracellular miR-155-5p and miR-27a-3p of the vesicle-associated miR-221-3p and an increase in vesicle-associated miR-33a-5p and miR-301-3p levels that are not present in the YAPC cell line.

Investigative Drug(s) 1 drug(s) in total

Celastrol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Celastrol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: LTEP-a-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Combination of celastrol and miR-33a-5p increases the expression of miR-33a-5p to inhibit the mTOR signaling pathway.

References

• Ref 1: Downregulation of miR-33a-5p in Hepatocellular Carcinoma: A Possible Mechanism for Chemotherapy Resistance. Med Sci Monit. 2017 Mar 14;23:1295-1304. doi: 10.12659/msm.902692.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 3: miR-33a-5p enhances the sensitivity of lung adenocarcinoma cells to celastrol by regulating mTOR signaling. Int J Oncol. 2018 Apr;52(4):1328-1338. doi: 10.3892/ijo.2018.4276. Epub 2018 Feb 14.