Molecule Information
General Information of the Molecule (ID: Mol01555)
Name |
hsa-miR-33a-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 33a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GUGCAUUGUAGUUGCAUUGCA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 |
MHCC97-L cells | Liver | Homo sapiens (Human) | CVCL_4973 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | HSPA8 was the direct downstream target gene for miR33a-mediated drug resistance. Inhibition of miR33a-5p expression reduced cisplatin sensitivity in Hep3B and 97L and increased their drug resistance. |
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung adenocarcinoma | [2] | |||
Sensitive Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
Sensitive Drug | Celastrol | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
LTEP-a-2 cells | Lung | Homo sapiens (Human) | CVCL_6929 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Combination of celastrol and miR-33a-5p increases the expression of miR-33a-5p to inhibit the mTOR signaling pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.