Molecule Information
General Information of the Molecule (ID: Mol01550)
Name |
hsa-miR-22-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 22
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AAGCUGCCAGUUGAAGAACUGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Epirubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Pirarubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Hydroxycamptothecin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
HTB-1 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.