Molecule Information

General Information of the Molecule (ID: Mol01549)

• Name: hsa-miR-21-5p ,Homo sapiens
• Synonyms: microRNA 21
• Molecule Type: Mature miRNA
• Sequence: UAGCUUAUCAGACUGAUGUUGA
• Ensembl ID: ENSG00000284190
• HGNC ID: HGNC:31586
• Mature Accession: MIMAT0000076

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Luciferase reporter assay; RNA immunoprecipitation (RIP) assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Caspase-3 activity analysis
• Mechanism Description: LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR21-5p/SOX7 axis. miR21-5p significantly abolished the effects of MEG3 on DDP resistance via modulating cell proliferation and apoptosis. SOX7 was identified as a direct target of miR21-5p and MEG3 positively regulated SOX7 expression by suppressing miR21-5p.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Suppression of miR-21-5p expression sensitizes SGC7901/DOX cells to DOX via upregulating PTEN and TIMP3.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: This case-control study, aimed to evaluate the expression profiles of specific microRNAs (miRNAs)-miR-155-5p, miR-21-5p, miR-93-5p, and miR-140-5p-in 50 female BC patients treated with paclitaxel (PTX) compared to 50 healthy controls. miRNA expression was analyzed using qPCR. The study revealed significant up regulation of these miRNAs in BC patients, with miR-155-5p and miR-21-5p demonstrating the highest diagnostic accuracy (AUC = 0.890 and 0.863, respectively). These miRNAs are implicated in key oncogenic processes, including tumor growth, angiogenesis, metastasis, and chemoresistance, highlighting their potential as non-invasive biomarkers for BC diagnosis and prognosis.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [5]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR-21-5p/SOX7 axis. Onco Targets Ther. 2017 Oct 25;10:5137-5149. doi: 10.2147/OTT.S146423. eCollection 2017.
• Ref 2: miR 21 5p confers doxorubicin resistance in gastric cancer cells by targeting PTEN and TIMP3. Int J Mol Med. 2018 Apr;41(4):1855-1866. doi: 10.3892/ijmm.2018.3405. Epub 2018 Jan 18.
• Ref 3: A panel of serum exosomal microRNAs as predictive markers for chemoresistance in advanced colorectal cancer. Cancer Chemother Pharmacol. 2019 Aug;84(2):315-325. doi: 10.1007/s00280-019-03867-6. Epub 2019 May 14.
• Ref 4: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
• Ref 5: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.