Molecule Information

General Information of the Molecule (ID: Mol01548)

Name	hsa-miR-20a-5p ,Homo sapiens
Synonyms	microRNA 20a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UAAAGUGCUUAUAGUGCAGGUAG Click to Show/Hide
Ensembl ID	ENSG00000283762
HGNC ID	HGNC:31577
Mature Accession	MIMAT0000075
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	G-292 cells	Bone	Homo sapiens (Human)	CVCL_2909
	SJSA-1 cells	Bone	Homo sapiens (Human)	CVCL_1697
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR20a-5p modulates multi-drug resistance by repressing SDC2 expression in OS cells.

Etoposide

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0]				[1]
Resistant Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Resistant Drug	Etoposide			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	G-292 cells	Bone	Homo sapiens (Human)	CVCL_2909
	SJSA-1 cells	Bone	Homo sapiens (Human)	CVCL_1697
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR20a-5p modulates multi-drug resistance by repressing SDC2 expression in OS cells.

Gemcitabine

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3]				[2]
Sensitive Disease	Pancreatic cancer [ICD-11: 2C10.3]			Disease Info
Sensitive Drug	Gemcitabine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell viability		Inhibition	hsa05200
In Vitro Model	MIA PaCa-2 cells	Pancreas	Homo sapiens (Human)	CVCL_0428
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	miR-20a-5p inhibits protein expression of RRM2 and reverses gemcitabine resistance.

References

Ref 1	MiR-20a-5p represses the multi-drug resistance of osteosarcoma by targeting the SDC2 gene. Cancer Cell Int. 2017 Nov 2;17:100. doi: 10.1186/s12935-017-0470-2. eCollection 2017.
Ref 2	MiR-20a-5p regulates gemcitabine chemosensitivity by targeting RRM2 in pancreatic cancer cells and serves as a predictor for gemcitabine-based chemotherapy. Biosci Rep. 2019 May 7;39(5):BSR20181374. doi: 10.1042/BSR20181374. Print 2019 May 31.