General Information of the Molecule (ID: Mol01540)
Name
hsa-mir-942 ,Homo sapiens
Synonyms
microRNA 942
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR942
Gene ID
100126331
Location
chr1:117094643-117094728[+]
Sequence
AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUACUCACAGCCCCUCACACAUGGC
CGAAACAGAGAAGUUACUUUCCUAAU
    Click to Show/Hide
Ensembl ID
ENSG00000215930
HGNC ID
HGNC:33688
Precursor Accession
MI0005767
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR-942-5p/NFIB Regulation N.A.
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
HEY cells Ovary Homo sapiens (Human) CVCL_0297
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Dual-luciferase reporter assay; Western blot
Experiment for
Drug Resistance
CCK8 assay; Cell colony formation assay; Flow cytometry analysis
Mechanism Description Mechanistically, circ-PIP5K1A acted as a sponge for miR-942-5p to positively regulate NFIB expression
Sunitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]
Resistant Disease Renal cell carcinoma [ICD-11: 2C90.0]
Resistant Drug Sunitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Caki-2 cells Kidney Homo sapiens (Human) CVCL_0235
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description High miR-942 levels in MRCC cells up-regulates MMP-9 and VEGF secretion to enhance endothelial migration and sunitinib resistance.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
In Vitro Model HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [3]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HLCZ01 cells Hepatoma Homo sapiens (Human) CVCL_1J92
LH86 cells Hepatoma Homo sapiens (Human) CVCL_8889
HLCZ02 cells Liver Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.
Disease Class: Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2] [3]
Resistant Disease Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2]
Resistant Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.
References
Ref 1 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 2 Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. doi: 10.1371/journal.pone.0086263. eCollection 2014.
Ref 3 miR-942 decreases TRAIL-induced apoptosis through ISG12a downregulation and is regulated by AKT. Oncotarget. 2014 Jul 15;5(13):4959-71. doi: 10.18632/oncotarget.2067.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.