Molecule Information
General Information of the Molecule (ID: Mol01540)
Name |
hsa-mir-942
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 942
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR942
|
||||
Gene ID | |||||
Location |
chr1:117094643-117094728[+]
|
||||
Sequence |
AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUACUCACAGCCCCUCACACAUGGC
CGAAACAGAGAAGUUACUUUCCUAAU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Renal cell carcinoma | [1] | |||
Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
Resistant Drug | Sunitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | Caki-2 cells | Kidney | Homo sapiens (Human) | CVCL_0235 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | High miR-942 levels in MRCC cells up-regulates MMP-9 and VEGF secretion to enhance endothelial migration and sunitinib resistance. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | TRAIL | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
In Vitro Model | HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. | |||
Disease Class: Hepatocellular carcinoma | [2] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | TRAIL | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HLCZ01 cells | Hepatoma | Homo sapiens (Human) | CVCL_1J92 | |
LH86 cells | Hepatoma | Homo sapiens (Human) | CVCL_8889 | |
HLCZ02 cells | Liver | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. | |||
Disease Class: Human papillomavirus-related endocervical adenocarcinoma | [2] | |||
Resistant Disease | Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2] | |||
Resistant Drug | TRAIL | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.