Molecule Information
General Information of the Molecule (ID: Mol01540)
| Name |
hsa-mir-942
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 942
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR942
|
||||
| Gene ID | |||||
| Location |
chr1:117094643-117094728[+]
|
||||
| Sequence |
AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUACUCACAGCCCCUCACACAUGGC
CGAAACAGAGAAGUUACUUUCCUAAU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | miR-942-5p/NFIB | Regulation | N.A. | |
| In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
| HEY cells | Ovary | Homo sapiens (Human) | CVCL_0297 | |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay; Western blot | |||
| Experiment for Drug Resistance |
CCK8 assay; Cell colony formation assay; Flow cytometry analysis | |||
| Mechanism Description | Mechanistically, circ-PIP5K1A acted as a sponge for miR-942-5p to positively regulate NFIB expression | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [2] | |||
| Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Resistant Drug | Sunitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Caki-2 cells | Kidney | Homo sapiens (Human) | CVCL_0235 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | High miR-942 levels in MRCC cells up-regulates MMP-9 and VEGF secretion to enhance endothelial migration and sunitinib resistance. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| In Vitro Model | HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [3] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HLCZ01 cells | Hepatoma | Homo sapiens (Human) | CVCL_1J92 | |
| LH86 cells | Hepatoma | Homo sapiens (Human) | CVCL_8889 | |
| HLCZ02 cells | Liver | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. | |||
| Disease Class: Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2] | [3] | |||
| Resistant Disease | Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2] | |||
| Resistant Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
