Molecule Information

General Information of the Molecule (ID: Mol01536)

Name	hsa-mir-873 ,Homo sapiens
Synonyms	microRNA 873 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR873
Gene ID	100126316
Location	chr9:28888879-28888955[-]
Sequence	GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUU CCCGGGAACACCCACAA Click to Show/Hide
Ensembl ID	ENSG00000215939
HGNC ID	HGNC:33663
Precursor Accession	MI0005564
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Glioma				[1]
Sensitive Disease	Glioma [ICD-11: 2A00.1]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell invasion		Inhibition	hsa05200
	Cell migration		Inhibition	hsa04670
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	U251 cells	Brain	Homo sapiens (Human)	CVCL_0021
	U87 cells	Brain	Homo sapiens (Human)	CVCL_0022
Experiment for Molecule Alteration	qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Bcl-2 was a direct target of miR 873, and miR 873 decreased the level of the Bcl-2 protein in cisplatin-resistant glioma cells. Notably, re-expression of Bcl-2 attenuated the function of miR 873 in cisplatin-resistant glioma cells and the sensitivity of the cells to cisplatin.

Gefitinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer				[2]
Resistant Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Resistant Drug	Gefitinib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell autophagy		Activation	hsa04140
	Cell viability		Activation	hsa05200
In Vitro Model	PC9 cells	Lung	Homo sapiens (Human)	CVCL_B260
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	The inhibition of miR-873 increased gefitinib resistance of NSCLC cells via the upregulation of GLI1.

References

Ref 1	MiR-873 acts as a novel sensitizer of glioma cells to cisplatin by targeting Bcl-2. Int J Oncol. 2015 Oct;47(4):1603-11. doi: 10.3892/ijo.2015.3143. Epub 2015 Aug 31.
Ref 2	MiR-873 inhibition enhances gefitinib resistance in non-small cell lung cancer cells by targeting glioma-associated oncogene homolog 1. Thorac Cancer. 2018 Oct;9(10):1262-1270. doi: 10.1111/1759-7714.12830. Epub 2018 Aug 20.