Molecule Information
General Information of the Molecule (ID: Mol01536)
| Name |
hsa-mir-873
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 873
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR873
|
||||
| Gene ID | |||||
| Location |
chr9:28888879-28888955[-]
|
||||
| Sequence |
GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUU
CCCGGGAACACCCACAA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [1] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Bcl-2 was a direct target of miR 873, and miR 873 decreased the level of the Bcl-2 protein in cisplatin-resistant glioma cells. Notably, re-expression of Bcl-2 attenuated the function of miR 873 in cisplatin-resistant glioma cells and the sensitivity of the cells to cisplatin. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [2] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Gefitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell autophagy | Activation | hsa04140 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | The inhibition of miR-873 increased gefitinib resistance of NSCLC cells via the upregulation of GLI1. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
