Molecule Information

General Information of the Molecule (ID: Mol01536)

• Name: hsa-mir-873 ,Homo sapiens
• Synonyms: microRNA 873
• Molecule Type: Precursor miRNA
• Gene Name: MIR873
• Gene ID: 100126316
• Location: chr9:28888879-28888955[-]
• Sequence:
  GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUU
  CCCGGGAACACCCACAA
• Ensembl ID: ENSG00000215939
• HGNC ID: HGNC:33663
• Precursor Accession: MI0005564

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [ICD-11: 2A00.1] [2]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Bcl-2 was a direct target of miR 873, and miR 873 decreased the level of the Bcl-2 protein in cisplatin-resistant glioma cells. Notably, re-expression of Bcl-2 attenuated the function of miR 873 in cisplatin-resistant glioma cells and the sensitivity of the cells to cisplatin.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-873/PD-L1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Luciferase reporter assay; RIP experiments
• Experiment for Drug Resistance: MTT assay; Flow cytometry analysis
• Mechanism Description: Finally, MTT assay was performed to determine the effects of miR-873/PD-L1 axis on drug resistance

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [4]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The inhibition of miR-873 increased gefitinib resistance of NSCLC cells via the upregulation of GLI1.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Dual-luciferase reporter assay; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Increasingly, microRNAs (miRNAs) including miR-873 have been implicated in drug resistance in many cancers, but the role of miR-873 in ovarian cancer remains unknown

Tamoxifen

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: HEK293T cells; Kindey; Homo sapiens (Human); CVCL_0063
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Dual luciferase assay; RT-PCR; Chromatin immunoprecipitation; Co-immunoprecipitation; Immunohistochemistry staining; Western blot
• Experiment for Drug Resistance: MTT assay; Soft agar assay
• Mechanism Description: Furthermore, we found that Mir-873 inhibits ER activity and cell growth via targeting CDK3.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MiR-873 acts as a novel sensitizer of glioma cells to cisplatin by targeting Bcl-2. Int J Oncol. 2015 Oct;47(4):1603-11. doi: 10.3892/ijo.2015.3143. Epub 2015 Aug 31.
• Ref 3: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 4: MiR-873 inhibition enhances gefitinib resistance in non-small cell lung cancer cells by targeting glioma-associated oncogene homolog 1. Thorac Cancer. 2018 Oct;9(10):1262-1270. doi: 10.1111/1759-7714.12830. Epub 2018 Aug 20.
• Ref 5: Intermittent High-Dose Scheduling of AZD8835, a Novel Selective Inhibitor of PI3KAlpha and PI3K Delta, Demonstrates Treatment Strategies for PIK3CA-Dependent Breast CancersMol Cancer Ther. 2016 May;15(5):877-89. doi: 10.1158/1535-7163.MCT-15-0687. Epub 2016 Feb 2.
• Ref 6: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.