Molecule Information
General Information of the Molecule (ID: Mol01536)
Name |
hsa-mir-873
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 873
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR873
|
||||
Gene ID | |||||
Location |
chr9:28888879-28888955[-]
|
||||
Sequence |
GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUU
CCCGGGAACACCCACAA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioma | [1] | |||
Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Bcl-2 was a direct target of miR 873, and miR 873 decreased the level of the Bcl-2 protein in cisplatin-resistant glioma cells. Notably, re-expression of Bcl-2 attenuated the function of miR 873 in cisplatin-resistant glioma cells and the sensitivity of the cells to cisplatin. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [2] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell autophagy | Activation | hsa04140 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | The inhibition of miR-873 increased gefitinib resistance of NSCLC cells via the upregulation of GLI1. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.