Molecule Information

General Information of the Molecule (ID: Mol01535)

• Name: hsa-mir-708 ,Homo sapiens
• Synonyms: microRNA 708
• Molecule Type: Precursor miRNA
• Gene Name: MIR708
• Gene ID: 100126333
• Location: chr11:79402022-79402109[-]
• Sequence:
  AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAAC
  UAGACUGUGAGCUUCUAGAGGGCAGGGA
• Ensembl ID: ENSG00000211997
• HGNC ID: HGNC:33654
• Precursor Accession: MI0005543

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: IGF2BP1/AKT signaling pathway; Inhibition; hsa05206
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: SkOV3/DDP cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780/DDP cells; Ovary; Homo sapiens (Human); CVCL_D619
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Caspase-3 activity assay
• Mechanism Description: miR708 increases the susceptibility of ovarian cancer cells to cisplatin by targeting IGF2BP1 and inhibiting Akt signaling. miR708 downregulated the expression of IGF2BP1 and suppressed Akt phosphorylation. Silencing of IGF2BP1 markedly blocked the phosphorylation of Akt.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Kidney cancer [ICD-11: 2C90.1] [2]

• Sensitive Disease: Kidney cancer [ICD-11: 2C90.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TRAIL-mediated signaling pathway; Regulation; N.A.
• In Vitro Model: Caki cells; Kidney; Homo sapiens (Human); CVCL_0234
• Experiment for Molecule Alteration: RT-PCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: C-FLIPL expression was upregulated while miR-708 expression was downregulated in RCC tissues compared to normal tissues. miR-708 functioned as a pro-apoptotic miRNA via specific downregulation of c-FLIPL expression but did not have any effect on the expression of c-FLIPs, which can also increase the drug sensitivity of renal cancer cells.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [3]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EWS/FLI1 /miR-708/EYA3; Regulation; N.A.
• Experiment for Molecule Alteration: Western blot; RT-PCR; Luciferase reporter assays
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: We further show that EWS/FLI1 mediates upregulation of EYA3 via repression of miR-708, a miRNA that targets the EYA3 3'-untranslated region, rather than by binding the EYA3 promoter directly

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HuH28 cells; Bile duct; Homo sapiens (Human); CVCL_2955
• In Vitro Model: HuCCT1 cells; Bile duct; Homo sapiens (Human); CVCL_0324
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Next we compared the HuH28 and HuCCT1 cell lines with regard to their innate miRNA expression profiles. Because HuCCT1 cells were more sensitive to Gem than were HuH28 cells, HuCCT1 cells were used as the standard in this comparison; expression of 10 miRNAs (miR-29b, 130a, 141, 200a, 200b, 200c, 205, 221, 222 and 429) was downregulated in HuH28 cells, while expression of eight others (miR-99b, 125a-5p, 143, 377, 452, 589, 597, and 708) was upregulated.

References

• Ref 1: Restoration of microRNA-708 sensitizes ovarian cancer cells to cisplatin via IGF2BP1/Akt pathway. Cell Biol Int. 2017 Oct;41(10):1110-1118. doi: 10.1002/cbin.10819. Epub 2017 Aug 17.
• Ref 2: Inhibition of c-FLIPL expression by miRNA-708 increases the sensitivity of renal cancer cells to anti-cancer drugs. Oncotarget. 2016 May 31;7(22):31832-46. doi: 10.18632/oncotarget.7149.
• Ref 3: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 4: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.