General Information of the Molecule (ID: Mol01535)
Name
hsa-mir-708 ,Homo sapiens
Synonyms
microRNA 708
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR708
Gene ID
100126333
Location
chr11:79402022-79402109[-]
Sequence
AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAAC
UAGACUGUGAGCUUCUAGAGGGCAGGGA
    Click to Show/Hide
Ensembl ID
ENSG00000211997
HGNC ID
HGNC:33654
Precursor Accession
MI0005543
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation IGF2BP1/AKT signaling pathway Inhibition hsa05206
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
SkOV3/DDP cells Ovary Homo sapiens (Human) CVCL_0532
A2780/DDP cells Ovary Homo sapiens (Human) CVCL_D619
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Caspase-3 activity assay
Mechanism Description miR708 increases the susceptibility of ovarian cancer cells to cisplatin by targeting IGF2BP1 and inhibiting Akt signaling. miR708 downregulated the expression of IGF2BP1 and suppressed Akt phosphorylation. Silencing of IGF2BP1 markedly blocked the phosphorylation of Akt.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Kidney cancer [ICD-11: 2C90.1] [2]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
TRAIL-mediated signaling pathway Regulation N.A.
In Vitro Model Caki cells Kidney Homo sapiens (Human) CVCL_0234
Experiment for
Molecule Alteration
RT-PCR; RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description C-FLIPL expression was upregulated while miR-708 expression was downregulated in RCC tissues compared to normal tissues. miR-708 functioned as a pro-apoptotic miRNA via specific downregulation of c-FLIPL expression but did not have any effect on the expression of c-FLIPs, which can also increase the drug sensitivity of renal cancer cells.
References
Ref 1 Restoration of microRNA-708 sensitizes ovarian cancer cells to cisplatin via IGF2BP1/Akt pathway. Cell Biol Int. 2017 Oct;41(10):1110-1118. doi: 10.1002/cbin.10819. Epub 2017 Aug 17.
Ref 2 Inhibition of c-FLIPL expression by miRNA-708 increases the sensitivity of renal cancer cells to anti-cancer drugs. Oncotarget. 2016 May 31;7(22):31832-46. doi: 10.18632/oncotarget.7149.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.