Molecule Information
General Information of the Molecule (ID: Mol01535)
Name |
hsa-mir-708
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 708
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR708
|
||||
Gene ID | |||||
Location |
chr11:79402022-79402109[-]
|
||||
Sequence |
AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAAC
UAGACUGUGAGCUUCUAGAGGGCAGGGA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | IGF2BP1/AKT signaling pathway | Inhibition | hsa05206 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
SkOV3/DDP cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
A2780/DDP cells | Ovary | Homo sapiens (Human) | CVCL_D619 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Caspase-3 activity assay | |||
Mechanism Description | miR708 increases the susceptibility of ovarian cancer cells to cisplatin by targeting IGF2BP1 and inhibiting Akt signaling. miR708 downregulated the expression of IGF2BP1 and suppressed Akt phosphorylation. Silencing of IGF2BP1 markedly blocked the phosphorylation of Akt. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Kidney cancer | [2] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
TRAIL-mediated signaling pathway | Regulation | hsa04210 | ||
In Vitro Model | Caki cells | Kidney | Homo sapiens (Human) | CVCL_0234 |
Experiment for Molecule Alteration |
RT-PCR; RT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | C-FLIPL expression was upregulated while miR-708 expression was downregulated in RCC tissues compared to normal tissues. miR-708 functioned as a pro-apoptotic miRNA via specific downregulation of c-FLIPL expression but did not have any effect on the expression of c-FLIPs, which can also increase the drug sensitivity of renal cancer cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.