Molecule Information
General Information of the Molecule (ID: Mol01516)
Name |
hsa-mir-503
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 503
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR503
|
||||
Gene ID | |||||
Location |
chrX:134546328-134546398[-]
|
||||
Sequence |
UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCG
CUGCCAGGGUA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR503 might be a sensitizer to cisplatin treatment in ovarian cancer by targeting PI3k p85 and participating in the regulation of the PI3k/Akt signaling pathway. The role of miR503 in regulating cisplatin sensitivity in ovarian cancer cells is correlated with the activation of PI3k/Akt signaling. | |||
Disease Class: Non-small cell lung cancer | [2], [3] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-503 plays a role in the development of drug resistance (Cisplatin) in human non-small cell lung cancer cells, at least in part by targeting the anti-apoptotic protein, Bcl-2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [4] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HL-7702 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR503 may enhance the sensitivity of BEL-7402 cells to cisplatin and inhibit the cell proliferation by targeting bcl-2. miR503 could interact with bcl-2 and inhibit its expression. | |||
Disease Class: Gastric cancer | [5] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
IGF1R signaling pathway | Inhibition | hsa05200 | ||
In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
BGC823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Clonogenic assay | |||
Mechanism Description | miR-503 was significantly downregulated in gastric cancer tissues and several gastric cancer cell lines. Additionally, downregulation of miR-503 in the cisplatin (DDP)-resistant gastric cancer cell line SGC7901/DDP was concurrent with the upregulation of insulin-like growth factor-1 receptor (IGF1R) and B-cell lymphoma 2 (BCL2) expression compared with the parental SGC7901 cell line. An in vitro drug sensitivity assay showed that overexpression of miR-503 sensitized SGC7901/DDP cells to cisplatin. The luciferase activity of reporters driven by IGF1R and BCL2 3'-untranslated regions in SGC7901/DDP cells suggested that IGF1R and BCL2 were both direct target genes of miR-503. Enforced miR-503 expression in SGC7901/DDP cells reduced expression of the target proteins, inhibited proliferation, and sensitized the cells to DDP-induced apoptosis. | |||
Disease Class: Lung cancer | [6] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Clonogenicity assay | |||
Mechanism Description | miR-503 was able to reverse the cisplatin resistance of A549/DDP. miR-503 processed this kind of effect by inhibiting the drug efflux, downregulating the expression of drug-resistant related proteins and promoting cell apoptosis. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [7] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins. | |||
Disease Class: Hepatocellular carcinoma | [8] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
Mechanism Description | The expression of a number drug resistance related proteins, including multidrug resistance 1, multi drug resistance associated protein 1, DNA excision repair protein ERCC 1, survivin and B cell lymphoma 2, was significantly downregulated by miR 503 overexpression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [9] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
L02 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR503 inhibits proliferation making human hepatocellular carcinoma cells susceptible to 5 fluorouracil by targeting EIF4E. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [7] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [7] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.