Molecule Information

General Information of the Molecule (ID: Mol01516)

• Name: hsa-mir-503 ,Homo sapiens
• Synonyms: microRNA 503
• Molecule Type: Precursor miRNA
• Gene Name: MIR503
• Gene ID: 574506
• Location: chrX:134546328-134546398[-]
• Sequence:
  UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCG
  CUGCCAGGGUA
• Ensembl ID: ENSG00000208005
• HGNC ID: HGNC:32138
• Precursor Accession: MI0003188

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR503 might be a sensitizer to cisplatin treatment in ovarian cancer by targeting PI3k p85 and participating in the regulation of the PI3k/Akt signaling pathway. The role of miR503 in regulating cisplatin sensitivity in ovarian cancer cells is correlated with the activation of PI3k/Akt signaling.

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2], [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-503 plays a role in the development of drug resistance (Cisplatin) in human non-small cell lung cancer cells, at least in part by targeting the anti-apoptotic protein, Bcl-2.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HL-7702 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR503 may enhance the sensitivity of BEL-7402 cells to cisplatin and inhibit the cell proliferation by targeting bcl-2. miR503 could interact with bcl-2 and inhibit its expression.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: IGF1R signaling pathway; Inhibition; hsa05200
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Clonogenic assay
• Mechanism Description: miR-503 was significantly downregulated in gastric cancer tissues and several gastric cancer cell lines. Additionally, downregulation of miR-503 in the cisplatin (DDP)-resistant gastric cancer cell line SGC7901/DDP was concurrent with the upregulation of insulin-like growth factor-1 receptor (IGF1R) and B-cell lymphoma 2 (BCL2) expression compared with the parental SGC7901 cell line. An in vitro drug sensitivity assay showed that overexpression of miR-503 sensitized SGC7901/DDP cells to cisplatin. The luciferase activity of reporters driven by IGF1R and BCL2 3'-untranslated regions in SGC7901/DDP cells suggested that IGF1R and BCL2 were both direct target genes of miR-503. Enforced miR-503 expression in SGC7901/DDP cells reduced expression of the target proteins, inhibited proliferation, and sensitized the cells to DDP-induced apoptosis.

Disease Class: Lung cancer [ICD-11: 2C25.5] [6]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Clonogenicity assay
• Mechanism Description: miR-503 was able to reverse the cisplatin resistance of A549/DDP. miR-503 processed this kind of effect by inhibiting the drug efflux, downregulating the expression of drug-resistant related proteins and promoting cell apoptosis.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: The expression of a number drug resistance related proteins, including multidrug resistance 1, multi drug resistance associated protein 1, DNA excision repair protein ERCC 1, survivin and B cell lymphoma 2, was significantly downregulated by miR 503 overexpression.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [10]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR503 inhibits proliferation making human hepatocellular carcinoma cells susceptible to 5 fluorouracil by targeting EIF4E.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [12]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: Water-soluble tetrazolium salt (WST)-based assay
• Mechanism Description: We then performed a comprehensive analysis of miRNA expressions in U251R and parental cells using miRNA microarrays. miR-195, miR-455-3p and miR-10a* were the three most up-regulated miRNAs in the resistant cells. Thirteen miRNAs were overexpressed (>2.0-fold) and two were underexpressed (<0.5-fold) in U251R cells compared to U251Wt cells. In addition, using in silico analysis combined with cDNA microarray experiment, we present possible mRNA targets of these miRNAs.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [13]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

Disease Class: Gastric cancer [ICD-11: 2B72.0] [13]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

References

• Ref 1: Downregulation of miR-503 contributes to the development of drug resistance in ovarian cancer by targeting PI3K p85. Arch Gynecol Obstet. 2018 Mar;297(3):699-707. doi: 10.1007/s00404-018-4649-0. Epub 2018 Jan 11.
• Ref 2: miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin by targeting Bcl-2. Int J Mol Med. 2013 Sep;32(3):593-8. doi: 10.3892/ijmm.2013.1439. Epub 2013 Jul 12.
• Ref 3: Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell. Biochem Biophys Res Commun. 2014 Feb 21;444(4):611-6. doi: 10.1016/j.bbrc.2014.01.103. Epub 2014 Jan 31.
• Ref 4: [MiR-503 sensitizes human hepatocellular carcinoma cells to cisplatin by targeting bcl-2]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2017 Jun 28;42(6):605-610. doi: 10.11817/j.issn.1672-7347.2017.06.001.
• Ref 5: MiR-503 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R and BCL2. Chin Med J (Engl). 2014;127(12):2357-62.
• Ref 6: [The reversing and molecular mechanisms of miR-503 on the drug-resistance to cisplatin in A549/DDP cells]. Zhongguo Fei Ai Za Zhi. 2014 Jan;17(1):1-7. doi: 10.3779/j.issn.1009-3419.2014.01.01.
• Ref 7: Downregulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins. Oncol Lett. 2017 Jun;13(6):4785-4793. doi: 10.3892/ol.2017.6049. Epub 2017 Apr 19.
• Ref 8: Role and mechanisms of microRNA 503 in drug resistance reversal in HepG2/ADM human hepatocellular carcinoma cells. Mol Med Rep. 2014 Dec;10(6):3268-74. doi: 10.3892/mmr.2014.2591. Epub 2014 Sep 22.
• Ref 9: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 10: miR-503 inhibits proliferation making human hepatocellular carcinoma cells susceptible to 5 fluorouracil by targeting EIF4E. Oncol Rep. 2017 Jan;37(1):563-570. doi: 10.3892/or.2016.5220. Epub 2016 Nov 7.
• Ref 11: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 12: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.
• Ref 13: miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.