General Information of the Molecule (ID: Mol01508)
Name
hsa-mir-193b ,Homo sapiens
Synonyms
microRNA 193b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR193B
Gene ID
574455
Location
chr16:14303967-14304049[+]
Sequence
GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCU
CAAAGUCCCGCUUUUGGGGUCAU
    Click to Show/Hide
Ensembl ID
ENSG00000207639
HGNC ID
HGNC:32087
Precursor Accession
MI0003137
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Urothelial carcinoma [1]
Sensitive Disease Urothelial carcinoma [ICD-11: 2C92.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NTUB1 cells Bladder Homo sapiens (Human) CVCL_RW29
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometer
Mechanism Description miR193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. miR193b-3p, a known tumor suppressor, down-regulated proto-oncogenes Cyclin D1, and ETS1 expression and led to cell cycle arrest, cell invasion, and migration inhibition.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
miR193b/MCL1 apoptosis signaling pathway Regulation hsa05206
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description MCL-1 was significantly overexpressed in MCF-7/DOXR cells, suggesting that the MCL-1 might be essential for doxorubicin resistance in breast cancer. Further results showed that MCL-1 was directly regulated by miR-193b, which is in accordance with the prior finding in melanoma. There was a negative correlation between the expression levels of miR-193b and MCL-1 in MCF-7/DOXR cells. Doxorubicin-induced apoptosis was inhibited in MCF-7/DOXR cells cotransfected with MCL-1 expression vector and miR-193b mimic, indicating that MCL-1 plays a pivotal role in mediating miR-193b-modulated doxorubicin resistance in human breast cancer.
Sorafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatitis B virus-associated hepatocellular carcinoma [3]
Sensitive Disease Hepatitis B virus-associated hepatocellular carcinoma [ICD-11: 2C12.7]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
L02 cells Liver Homo sapiens (Human) CVCL_6926
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description HBV infection in HCC cell lines enhances sorafenib resistance. HBV infection in HCC reduces miR-193b expression and increases Mcl-1 expression. miR-193b directly suppresses the expression of Mcl-1 through its 3'-UTRs. miR-193b facilitates sorafenib-induced apoptosis. miR-193b sensitizes HBV-associated HCC cell lines to sorafenib.
References
Ref 1 MiR-193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. J Cell Biochem. 2017 Jun;118(6):1563-1573. doi: 10.1002/jcb.25818. Epub 2016 Dec 20.
Ref 2 miR-193b Modulates Resistance to Doxorubicin in Human Breast Cancer Cells by Downregulating MCL-1. Biomed Res Int. 2015;2015:373574. doi: 10.1155/2015/373574. Epub 2015 Oct 7.
Ref 3 Restoration of miR-193b sensitizes Hepatitis B virus-associated hepatocellular carcinoma to sorafenib. Cancer Lett. 2014 Oct 1;352(2):245-52. doi: 10.1016/j.canlet.2014.07.004. Epub 2014 Jul 14.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.