Molecule Information

General Information of the Molecule (ID: Mol01508)

• Name: hsa-mir-193b ,Homo sapiens
• Synonyms: microRNA 193b
• Molecule Type: Precursor miRNA
• Gene Name: MIR193B
• Gene ID: 574455
• Location: chr16:14303967-14304049[+]
• Sequence:
  GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCU
  CAAAGUCCCGCUUUUGGGGUCAU
• Ensembl ID: ENSG00000207639
• HGNC ID: HGNC:32087
• Precursor Accession: MI0003137

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Urothelial carcinoma [ICD-11: 2C92.0] [3]

• Sensitive Disease: Urothelial carcinoma [ICD-11: 2C92.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: NTUB1 cells; Bladder; Homo sapiens (Human); CVCL_RW29
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometer
• Mechanism Description: miR193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. miR193b-3p, a known tumor suppressor, down-regulated proto-oncogenes Cyclin D1, and ETS1 expression and led to cell cycle arrest, cell invasion, and migration inhibition.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR193b/MCL1 apoptosis signaling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: MCL-1 was significantly overexpressed in MCF-7/DOXR cells, suggesting that the MCL-1 might be essential for doxorubicin resistance in breast cancer. Further results showed that MCL-1 was directly regulated by miR-193b, which is in accordance with the prior finding in melanoma. There was a negative correlation between the expression levels of miR-193b and MCL-1 in MCF-7/DOXR cells. Doxorubicin-induced apoptosis was inhibited in MCF-7/DOXR cells cotransfected with MCL-1 expression vector and miR-193b mimic, indicating that MCL-1 plays a pivotal role in mediating miR-193b-modulated doxorubicin resistance in human breast cancer.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [6]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Microarrays assay; Gene expression levels analysis
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Hedgehog; Regulation; N.A.
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: Western blot; RT-qPCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: MiRNAs whose expression is different between PTX-resistant and sensitive prostate cancer cells. As can be seen, several miRNAs such as 1, 18a, 138, 29b, 200c, 34a and 126 were downregulated while 193b, 30c, 155, 146a, 10b, 10a, 17, 125b, 373, 144 and 31b were upregulated in PTX-resistant cells with respect to parental cells.

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatitis B virus-associated hepatocellular carcinoma [ICD-11: 2C12.7] [7]

• Sensitive Disease: Hepatitis B virus-associated hepatocellular carcinoma [ICD-11: 2C12.7]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: HBV infection in HCC cell lines enhances sorafenib resistance. HBV infection in HCC reduces miR-193b expression and increases Mcl-1 expression. miR-193b directly suppresses the expression of Mcl-1 through its 3'-UTRs. miR-193b facilitates sorafenib-induced apoptosis. miR-193b sensitizes HBV-associated HCC cell lines to sorafenib.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: Upregulation of microRNA-125b contributes to leukemogenesis and increases drug resistance in pediatric acute promyelocytic leukemia. Mol Cancer. 2011 Sep 1;10:108. doi: 10.1186/1476-4598-10-108.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: MiR-193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. J Cell Biochem. 2017 Jun;118(6):1563-1573. doi: 10.1002/jcb.25818. Epub 2016 Dec 20.
• Ref 4: miR-193b Modulates Resistance to Doxorubicin in Human Breast Cancer Cells by Downregulating MCL-1. Biomed Res Int. 2015;2015:373574. doi: 10.1155/2015/373574. Epub 2015 Oct 7.
• Ref 5: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 6: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 7: Restoration of miR-193b sensitizes Hepatitis B virus-associated hepatocellular carcinoma to sorafenib. Cancer Lett. 2014 Oct 1;352(2):245-52. doi: 10.1016/j.canlet.2014.07.004. Epub 2014 Jul 14.
• Ref 8: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.